Articles on this page are available in 2 other languages: French (1), German (1) (learn more)

Overview

Comprehensive Description

Taxonomic History

9 subspecies

Formica fusca Linnaeus, 1758 PDF: 580 (w.) EUROPE. AntCat AntWiki

Taxonomic history

Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Various habitats
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

6. Formica fusca HNS . The Ash-coloured Ant. B. M.

Formica fusca, Linn HNS . Faun. Suec. 1722. De Geer, Ins. ii. 1082, 3,

t. 42, f. 12, 15. Schrank, Ins. Aust. 413, 833. Oliv. Enc.

Meth. vi. 433. Fab. Ent. Syst. ii. 352, 11. Latr. Hist. Nat.

Fourm. 159, t. 6, f. 32. Jurine, Hym. 272. St. Farg. Hist.

Nat. Ins. 205, 6. Zett. Ins. Lapp. 448,4. Formica libera, Scop HNS . Ent. Carn. 313, 835. Formica nigra, Christ HNS . 510, t. 60, f. 6. [[ male ]] La Fourmi toute brune, Geoff. Ins. Par. ii. 428, 5. Huber, Fourm. 322, t. 2, f. 8,9,10.

Hab. - Britain, Banks.

  • Smith, F. (1851): List of the specimens of British animals in the collection of the British Museum. Part VI. - Hymenoptera Aculeata. London, British Museum: 3-3, URL:http://antbase.org/ants/publications/8200/8200.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

F. cinereo-fusca, tibiis pallidis.

Habitat in Europae terra sabulosa.

  • Linnaeus, C. (1758): Systema naturae. Regnum Animale. 10 th ed. Lipsiae, W. Engelmann: 580-580, URL:http://hdl.handle.net/10199/15420
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Formica fusca HNS .

Formica fusca, Linn HNS . Faun. Suec. 1722. Nyland. Adno. Mon. Form. Boreal. 919, 15.

  • Smith, F. (1851): List of the specimens of British animals in the collection of the British Museum. Part VI. - Hymenoptera Aculeata. London, British Museum: 10-10, URL:http://antbase.org/ants/publications/8200/8200.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

180. Formica fusca HNS . B.M.

Formica fusca, Linn. HNS Faun. Suec. no. 1722.

Hab. Europe and North America.

  • Smith, F. (1858): Catalogue of the hymenopterous insects in the collection of the British Museum. Part VI. Formicidae. London, British Museum: 52-52, URL:http://antbase.org/ants/publications/8127/8127.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

15. F. fusca Linn HNS .

Fn. Suec. 1722. Latr. Fourm. 159, pl. VI, fig. 32. [[ worker ]] [[ queen ]] [[ male ]]. Fabr. Piez. 392, 13. Hueber Rech. Fourm, pl. 2, fig. 8, 9, 10, [[ queen ]] [[ worker ]] [[ male ]]. Zett. Ins. Lapp. 448, 4. Lepel. S: t Farg. Hymen. 205, 6. Dahlb. mscrpt.

Femina: fusco-nigra nitida cinereo-micans, mandibulis rufescenlibus, antennarum scapis pedibusque ferrugineo-lestaceis; alis albo-hyalinis, nervis et stigmate fuscis; squama lata triaugulariter subrotundata; abdomine polito, subnudo.

Mas: fusco-niger nitidus cinereo-micans, antennarum scapis saepissime et pedibus genitalibusque testaceo-flavescentibus; squama crassa subquadrata; supra concaviuscula.

Habitare videtur in omnibus regiqnibus Europae. In Fennia occurrunt mares teminaeque sub m. Junio et Julio parcius.

[[ worker ]]. (Operariam hujus hucusque ab operaria prascedentis notis positivis distinguere haud valeo, nec conjecturas audeo, quando eam numquam simul cum femina in nido observavi; determinado igitur omnis differenda, donec melius docuerit experientia).

[[ queen ]]. Long. 3 1 / 2 lin. Simillima [[ queen ]] praecedentis, tamen sequentibus notis distincta. Magnitudo paullo major. Caput et thorax dense subtiliter adpresse cinereo-pubescentia, micantia. Occiput thoracis latitudine. Antennae scapis et basibus flagellorum testaceo-ferrugineis. Alas albo-hyalinae, nervis et stigmate fuscis, radice et tegula testaceis nitidis; alae anticae 3 1 / 2 lin. longae. Prothoracis margo pleuralis et sternalis rufescens. Pedes pallide testaceo-ferruginei, coxis prater apicem fuscis. Abdomen nitidissimum subaenescens, thorace paulo longius ovale, latius et depressius quam in procedente, segmento tertio latiori quam secundo, multo latiori quam quarto; segmentis omnibus subtilissime sparse adpresse cinereo-pubescentibus, basibus late nudis politis, apicibus praesertim in lateribus et ventre membranaceo-pallescentibus; segmentum secundum ad basin supra utrinque trausversum obsolete impressum; anus summus rufescens.

[[ male ]]. Long. 3 1 / 2 lin. habitu similis feminae, formatione partium apud mares in hac subdivisione solita. Mandibula; apice rufescentes. Oculi prominuli nudi; ocelli in prominentia obsoleta verticis. Antennae scapis vel pallide testaceis vel obscuris. Thorax tamquam caput sericeo-micans. Alae ut in [[ worker ]], interdum obsoletissime fuscescentes; anticae long. 3 lin. Pedes pallide testacei coxis plus minus fuscis et articulo tarsorum ultimo parum obscuro. Abdomen sericeo nitens paulum subaenescens, interdum brunnescens, marginibus segmentorum certo situ cinerascenti-membranaceis. Genitalia cum valvula ventrali flavidopilosula, pallide testacea.

  • Nylander, W. (1846): Adnotationes in monographiam formicarum borealium Europae. Acta Societatis Scientiarum Fennicae 2, 875-944: 919-920, URL:http://antbase.org/ants/publications/4277/4277.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

10. Formica fusca HNS . Pl. III. fig. 14. B.M.

Formica fusca, Linn. HNS Faun. Suec. 226.1722; Syst. Nat. i. 963.4.

Fabr. Ent. Syst. ii. 352. 11; Syst. Piez. 399.13.

Schrank, Ins. Austr. 413.

Latr. Hist. Nat. Fourm. 159. pl. 6. f. 32. A. [[worker]]. E. [[male]].

Oliv. Encycl. Meth. vi. 493.13.

Huber,.Rech. Fourm. t. 2. f. 8, 9, 10.

Zett. Ins. Lapp. 448.

Brulle, Hist. Nat. II. Canar. iii. 84. 3.

Losana, Form. Piem. 317.

St. Farg. Hym. i. 205. 6. Nyt. Adno. Mon. Form. Bor. 919. 15; Addit. Alter. 30;

Form. Fr. et d'Alger. 65. 20.

Schenck, Beschr. Nass. Ameis. 43.

Smith, Brit. Form. 104. 4.

Mayr. Form. Austr. 74.17; Ungar. Ameis. 11. 16.

Formica glebaria HNS , Nyl. Adno. Mon. Form. Bor. 917.14.

Foerst. Hym. Stud. Form. 31. 13.

Hab. Britain; France; Germany; Austria; Hungary; Finland; Madeira.

  • Smith, F. (1858): Catalogue of the hymenopterous insects in the collection of the British Museum. Part VI. Formicidae. London, British Museum: 5-6, URL:http://antbase.org/ants/publications/8127/8127.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

43. Formica fusca Linne HNS , 1758

Figs. 159,165,176-179.

Formica fusca Linne HNS , 1758:580; Yarrow, 1954:228 (redescription).

Worker. Black, legs brownish. Gula, occiput, mid femora and promesonotum without standing hairs - occasionally one or two weak pronotal hairs. Pubescent hairs on gaster longer than their interspace width. Frons with fine microsculpture. Length: 4.5-7.0 mm.

Queen. Colour and sculpture as worker. Pronotal hairs restricted to anterior part; underside of mid and hind femora without long hairs or those restricted to proximal part only. Scutellum sculptured, not conspicuously shining. Length: 7.0-9.5 mm.

Male. Black, appendages yellowish to brownish. Scale with dorsal fringe of very fine short hairs but no outstanding long hairs. Gaster with short adpressed pubescence. Length: 8.0-9.5 mm.

Distribution. Common throughout Denmark and Southern Fennoscandia to about latitude 63° in Finland. - Common in South England, Wales and Southwest Ireland, local in North England and Scotland. - Range: whole palaearctic region from Portugal to Japan, Italy to Central Fennoscandia.

Biology. This is the common black ant of Europe. It nests variously in banks, under stones and in tree stumps along hedgerows and woodland borders. Workers are timid, fast moving and forage singly, predating small insects but also feeding on extra floral nectaries and on aphid honeydew. Colonies are usually small with up to 500 workers and one or a few queens present. Alatae are developed in June and July and fly off the nests in July and early August.

  • Collingwood, C. A. (1979): The Formicidae (Hymenoptera) of Fennoscandia and Denmark. Fauna Entomologica Scandinavica 8, 1-174: 120-120, URL:http://antbase.org/ants/publications/6175/6175.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Formica fusca Linnaeus HNS 1758

  • Ward, P. S. (2005): A synoptic review of the ants of California (Hymenoptera: Formicidae). Zootaxa 936, 1-68: null, URL:http://antbase.org/ants/publications/21008/21008.pdf
Public Domain

Ward, P. S.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Throughout SLO
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Taxonomic Treatment

Nylander, W., 1846:
 Fn. Suec. 1722. Latr. Fourm. 159, pl. VI, fig. 32. [[ worker ]] [[ queen ]] [[ male ]]. Fabr. Piez. 392, 13. Hueber Rech. Fourm, pl. 2, fig. 8, 9, 10, [[ queen ]] [[ worker ]] [[ male ]]. Zett. Ins. Lapp. 448, 4. Lepel. S: t Farg. Hymen. 205, 6. Dahlb. mscrpt.
 Femina: fusco-nigra nitida cinereo-micans, mandibulis rufescenlibus, antennarum scapis pedibusque ferrugineo-lestaceis; alis albo-hyalinis, nervis et stigmate fuscis; squama lata triaugulariter subrotundata; abdomine polito, subnudo.
 Mas: fusco-niger nitidus cinereo-micans, antennarum scapis saepissime et pedibus genitalibusque testaceo-flavescentibus; squama crassa subquadrata; supra concaviuscula.
 Habitare videtur in omnibus regiqnibus Europae. In Fennia occurrunt mares teminaeque sub m. Junio et Julio parcius.
 [[ worker ]]. (Operariam hujus hucusque ab operaria prascedentis notis positivis distinguere haud valeo, nec conjecturas audeo, quando eam numquam simul cum femina in nido observavi; determinado igitur omnis differenda, donec melius docuerit experientia).
 [[ queen ]]. Long. 3 1 / 2 lin. Simillima [[ queen ]] praecedentis, tamen sequentibus notis distincta. Magnitudo paullo major. Caput et thorax dense subtiliter adpresse cinereo-pubescentia, micantia. Occiput thoracis latitudine. Antennae scapis et basibus flagellorum testaceo-ferrugineis. Alas albo-hyalinae, nervis et stigmate fuscis, radice et tegula testaceis nitidis; alae anticae 3 1 / 2 lin. longae. Prothoracis margo pleuralis et sternalis rufescens. Pedes pallide testaceo-ferruginei, coxis prater apicem fuscis. Abdomen nitidissimum subaenescens, thorace paulo longius ovale, latius et depressius quam in procedente, segmento tertio latiori quam secundo, multo latiori quam quarto; segmentis omnibus subtilissime sparse adpresse cinereo-pubescentibus, basibus late nudis politis, apicibus praesertim in lateribus et ventre membranaceo-pallescentibus; segmentum secundum ad basin supra utrinque trausversum obsolete impressum; anus summus rufescens.
 [[ male ]]. Long. 3 1 / 2 lin. habitu similis feminae, formatione partium apud mares in hac subdivisione solita. Mandibula; apice rufescentes. Oculi prominuli nudi; ocelli in prominentia obsoleta verticis. Antennae scapis vel pallide testaceis vel obscuris. Thorax tamquam caput sericeo-micans. Alae ut in [[ worker ]], interdum obsoletissime fuscescentes; anticae long. 3 lin. Pedes pallide testacei coxis plus minus fuscis et articulo tarsorum ultimo parum obscuro. Abdomen sericeo nitens paulum subaenescens, interdum brunnescens, marginibus segmentorum certo situ cinerascenti-membranaceis. Genitalia cum valvula ventrali flavidopilosula, pallide testacea.
 

Smith, F.:
  Formica fusca, Linn. Faun. Suec. 226.1722; Syst. Nat. i. 963.4.
  Fabr. Ent. Syst. ii. 352. 11; Syst. Piez. 399.13.
  Schrank, Ins. Austr. 413.
  Latr. Hist. Nat. Fourm. 159. pl. 6. f. 32. A. [[worker]]. E. [[male]].
  Oliv. Encycl. Meth. vi. 493.13.
  Huber,.Rech. Fourm. t. 2. f. 8, 9, 10.
  Zett. Ins. Lapp. 448.
  Brulle, Hist. Nat. II. Canar. iii. 84. 3.
  Losana, Form. Piem. 317.
  St. Farg. Hym. i. 205. 6. Nyt. Adno. Mon. Form. Bor. 919. 15; Addit. Alter. 30;
  Form. Fr. et d'Alger. 65. 20.
  Schenck, Beschr. Nass. Ameis. 43.
  Smith, Brit. Form. 104. 4.
  Mayr. Form. Austr. 74.17; Ungar. Ameis. 11. 16.
  Formica glebaria , Nyl. Adno. Mon. Form. Bor. 917.14.
  Foerst. Hym. Stud. Form. 31. 13.
  Hab. Britain; France; Germany; Austria; Hungary; Finland; Madeira.
  Formica fusca, Linn. Faun. Suec. no. 1722.
  Hab. Europe and North America.
 

Förster, A.:
  Lin. System, nat. ed. 12, tom. 1. pag. 963,. 4, -Faun. Suec. ed. 2, n 1722, et ed. 1. n 1021. - Form. nigra Latr. p. 156. [[ worker ]] [[queen]] [[male]]. - Lep. de St. Farg. Hym. 206, 7. - Nyl. Adn. p. 920, 16.
  Operaria: Fusca tota, cineraseenti-micaas, nitida, sparse flavido-pilosula, anteanarom scapis pedibusque(praeter pubescentiam adpressam), tenuissime alho-pilosulis; mandibulis rufis confertim rugosis, punetatis; elypeo subtiliter ruguloso, foveolis lateralibus laevibus; area frontali subtilissime punctulata, subnitida; squama subrectangulari, supra parum vel vis emarginata. Lg. 1-IV, lin.
  Femina: Fusco-nigrescens, dense undique cinereo-micans, nitida, mandibulis, antennarum scapo cum pedicello obscure rufescenUbus, pedum articulationibus tarsisque ferrugineo-pallescentibus; mandibulis confertim rugosis, fortiter punetatis; clypeo subtiliter ruguloso foveolis lateralibus Iaevibus; area frontali subtilissime punctulata, nitida; alis albo-hyalinis, nervis et stigmate pallide flavidis, subradio fusco; squama verticaliter subrectangulari, supra angulis rotundatis et medio subangulatim emarginato. Lg. 3 1/2 lin.
  Mas: Fusco-niger, parum cinereo-micans, nitidus, antennarnm flagellis fuscescentibus tarsisque obscure pallescentibus, (Ulis articulo primo crassiusculo); clypeo cum area frontali subrugulosis, subopacis; alis albo-hyalinis, nervis et stigmate pallide flavidis; squama exigua subrectangulari, supra parum coneaviuscula. Lg. 1 3/4-2 lin.
  Die Art, welche ich hier als F. fusca L. aufstelle, wird von Latreille und sicherlich gestützt auf dessen Autorität auch von Nylander als F. nigra L. gedeutet, aber wie mir scheint, mit Unrecht,* denn Linne's Diagnose, welche er von seiner fusca aufstellt, pafst auf vorstehende Art doch besser als die, welche er für die Form nigra angibt, nämlich : tota nigra, nitida, tibiis oinerascentibus. Der Name fusca pafst auch für die hier bezeichnete Art weit besser als der von Latr. und Nyl. gebrauchte. Der letztere Schriftsteller bezeichnete auch seine nigra (unsre fusca ) nicht mit dieser Farbe in der Diagnose, sondern er braucht den Ausdruck fusco-nigrescens,oder fusco-niger, was uns in unsrer Ansicht noch bestärken muß . Als Form. fusca finde ich unsre Art auch in der Neesischen Sammlung und sie wurde mir yon verschiedenen Seiten unter diesem Namen zugesendet.
  Der Arbeiter dieser Art hat eine braune Grundfarbe, welche am Mittelleib mehr oder weniger röthlich durchscheint, die Mandibeln, der Schaft mit dem Stielchen, mitunter auch die Geißel sind an der Basis mehr oder weniger roth, die Tarsen etwas heller röthlich gefärbt . Der ganze Körper ist sehr fein runzlig, mit einer bräunlich-grauen , anliegenden Pubescenz dicht bedeckt und mit gelblichen Borstenhaaren bekleidet, welche an dem Fühlerschaft und den Beinen etwas feiner und mehr weißlich erscheinen. Die Mandibeln dicht längsrunzlig , ziemlich deutlich punktirt, der Clypeus schwach runzlig mit glatten Seitengruben; das Stirnfeld äußerst fein punktirt, glänzend ; die Stirnrinne sehr fein und vor den Nebenaugen abbrechend. Die Augen fast kahl, die Nebenaugen sehr klein. Der Mittelleib bräunlich , etwas röthlich durchscheinend, der Hinterbrustruecken an der abschüssigen Stelle viel länger als an dem Basaltheil, regelmäßig dreiseitig, oben spitz, sehr stark glänzend , nur der Rand überall fein punktirt, matt. Die Beine braun, die Trochanteren, die Kniee, die Spitze der Schienen und die Tarsen röthlich . Die Schuppe fast rechtwinklig, oben sehr wenig oder kaum ausgerandet, schwach gewimpert, der Hinterleib braun, dicht mit anliegenden, graubraunen Härchen bedeckt, und reichlich mit abstehenden, längeren Borstenhaaren versehen.
  Das Weibchen zeichnet sich von dem Arbeiter gleich durch seine bedeutende Größe aus, es ist tiefer braun gefärbt , schwärzlich , hat dieselbe Sculptur und Pubescenz wie der Arbeiter, und dieselben Borstenhaare. Die Mandibeln sind roth, nicht so dicht aber stärker runzlig und stärker punktirt als bei dem Arbeiter. Der Clypeus kaum runzlig, aber in der Mitte deutlich punktirt, die Seitengruben glatt; das Stirnfeld mit wenigen, äußerst schwachen Pünktchen , glänzend ; die Stirnrinne geht bis zu den Nebenaugen durch; die Augen kurzhaarig, die Nebenaugen groß . An den Fühlern der Schaft und das Stielchen roth, letzteres mitunter mehr oder weniger bräunlich . Am Mittelleib der Mittelbrustrücken sammt dem Schildchen schwächer runzlig, daher mehr glänzend ; der Hinterbrustrücken dagegen in der Mitte fast von der Basis an völlig glatt und sehr stark glänzend . Die Flügel wasserhell, die Adern und das Randmal gelblich; alle Längsadern an der Basis, die Unterrandader sogar bis zum Randmal hinauf bräunlich . Die Isle Diskoidalzelle mehr oder weniger fast kubisch, oder oben stark 2/3 der Basalbreite betragend. Die Beine braun mit röthlichen Tarsen, auch die Tibien schimmern röthlich-durch . Die Schuppe von oben gesehen fast rechtwinklig, die Winkel oben zugerundet, in der Mitte ziemlich tief, faßt winklig ausgerandet und ringsum gewimpert. Der Hinterleib verhältnißtnäßig sehr groß , breiter als der Mittelleib, die Pubescenz äußerst dicht.
  Das Männchen ist wieder im Verhältniß zu dem Weibchen sehr klein und übertrifft den Arbeiter nur wenig an Größe , die Färbung ist indeß mehr schwarzbraun, die Pubescenz auf Kopf und Thorax weniger dicht, und der letztre auch nur mit zerstreuten, kürzeren Borstenhaaren. Die einzähnigen Mandibeln sind fein runzlig, der Clypeus und das Stirnfeld ebenso, letzteres fast glanzlos. Die Stirnrinne tief, bis zu den Nebenaugen hinaußteigend , die sehr groß sind; die Netzaugen sehr kurz und spärlich behaart. Der Fühlerschaft braun, die Fühlergeissel schmutzig gelb, oder gelbbräunlich , das Stielchen an der Spitze kugelig-verdickt. Der Mittelleib um das Schildchen herum gewöhnlich schwach röthlich durchscheinend, die abschüssige Stelle des Hinterrückens in der Mitte glatt und glänzend . Die Flügel wasserhell, die Adern und das Randmal gelblich, die Längsadern an der Basis, die Unterrandader zwar etwas mehr als die übrigen aber doch bei weitem nicht bis zum Randmal hinauf sehwach bräunlich . Die Beine braun, die Tarsen nach der Spitze allmählig mehr röthlich . An den Beinen sowohl wie am Schaft finden sich nur sehr wenige, zerstreute und nicht leicht in die Augen fallende, feine Borstenhaare. Die Schuppe klein mit langen Wimperhaaren, oben entweder etwas eingedrückt , oder breit und scwach ausgerandet. Am Hinterleib ist die Pubescenz stärker als andern Mittelleib, die Borstenhaare stehen gedrängter und dichter und sind länger . Die äußeren Genitalklappen sind besonders langborstig.
  Diese Art ist in hiesiger Gegend sehr verbreitet, der Arbeiter besonders häufig in Gärten und man möchte sagen auf allen Pflanzen anzutreffen. Nach Latr. ist es auch die häufigste Art in Frankreich, nach Nyl. geht sie bis nach Lappland hinauf, und ist also auch im höchsten Norden noch zu finden. Sie lebt unter Steinen, macht aber auch selbständige , kleine Erdhaufen nach Art der Form. flava . Ihre Kolonieen sind meist sehr bevölkert . In sandigen Gegenden macht sie an der Oberfläche oft lange, verdeckte Gänge , die man an der staubartigen, pulverigen Masse leicht erkennen kann. Ihre Lebensweise ist noch wenig erforscht.
 

Forel, A., 1890:
  var. des prés . Tébessa (jardins près de la ville).
 

Smith, F.:
  Formica fusca, Linn . Faun. Suec. 1722. De Geer, Ins. ii. 1082, 3,
  t. 42, f. 12, 15. Schrank, Ins. Aust. 413, 833. Oliv. Enc.
  Meth. vi. 433. Fab. Ent. Syst. ii. 352, 11. Latr. Hist. Nat.
  Fourm. 159, t. 6, f. 32. Jurine, Hym. 272. St. Farg. Hist.
  Nat. Ins. 205, 6. Zett. Ins. Lapp. 448,4. Formica libera, Scop . Ent. Carn. 313, 835. Formica nigra, Christ . 510, t. 60, f. 6. [[ male ]] La Fourmi toute brune, Geoff. Ins. Par. ii. 428, 5. Huber, Fourm. 322, t. 2, f. 8,9,10.
  Hab. - Britain, Banks.
  Formica fusca, Linn . Faun. Suec. 1722. Nyland. Adno. Mon. Form. Boreal. 919, 15.
 

Ward, P. S., 2005:
 

Forel, A., 1904:
 Transcaucasie occid., Gouv. Kutais, Artvin, 1 [[ worker ]], 23. VI. 1898 (Derjugin!).
 

Forel, A., 1894:
  Lahoul, frontiere du Thibet (Major Sage), Thibet (par M. Wroughton). Identique aux individus europeens. Yarkand (Smith). La F. candida Smith est evidemment une F. gagates . Race F. fusca , i. sp., L. = F. glebaria , Nyl. Mussoric Hills (M. Smythies). Pachmarhi pres de Jubulpore, Inde centrale (M. Schurr). Indentique aux individus europeens. Race F. rufibarbis (Fab.) = F. cunicularia (Latr.) = F. obsoleta (Latr.) = F. stenoptera (Foerst.) = F. fraterna et F. defensor (Smith?) Dharmsala (Major Sage). Lahoul, frontiere du Thibet (Major Sage), Identique aux exemplaies europeens. La F. fraterna (Smith) est evidemment la F. rufibarbis . La F. defensor (Smith) est peut-etre la vari t suivante.
 
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Records

 

(Map 65): Bulgaria ( Agosti and Collingwood 1987a , Atanassov and Dlusskij 1992 ); Western Danubian Plain: Vidin ( Gateva 1975 ); Central Predbalkan: Dermantsi vill. (Lukovit) ( Atanassov 1934 ); Sofia Basin: Sofia, Vrania palace ( Atanassov 1934 ), the surroundings of Sofia ( Atanassov 1934 , Antonova 2005 , Antonova and Penev 2006 ); Vitosha Mt. ( Atanassov 1952 ); Plana Mt.: Plana vill., Kokalyane monastery (Kokalyane vill.), Bukov dol loc. (Pasarel vill.) ( Vagalinski and Lapeva-Gjonova in press ); Lozenska Planina Mt. ( Vassilev and Evtimov 1973 ): German monastery ( Atanassov 1934 ); Thracian Lowland: Krichim ( Atanassov 1934 ); Rila Mt.: Elenin peak ( Forel 1892 ); Slavianka Mt.: Alibotush reserve ( Antonova 2009 ); Western Rhodopi Mts: Smolyan ( Gateva 1975 , Lapeva-Gjonova in press (a) ), Peshtera ( Lapeva-Gjonova in press (a) ).

License not applicable

Lapeva-Gjonova, Albena

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

var. des prés . Tébessa (jardins près de la ville).

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lahoul, frontiere du Thibet (Major Sage), Thibet (par M. Wroughton). Identique aux individus europeens. Yarkand (Smith). La F. candida Smith est evidemment une F. gagates . Race F. fusca , i. sp., L. = F. glebaria , Nyl. Mussoric Hills (M. Smythies). Pachmarhi pres de Jubulpore, Inde centrale (M. Schurr). Indentique aux individus europeens. Race F. rufibarbis (Fab.) = F. cunicularia (Latr.) = F. obsoleta (Latr.) = F. stenoptera (Foerst.) = F. fraterna et F. defensor (Smith?) Dharmsala (Major Sage). Lahoul, frontiere du Thibet (Major Sage), Identique aux exemplaies europeens. La F. fraterna (Smith) est evidemment la F. rufibarbis . La F. defensor (Smith) est peut-etre la vari t suivante.

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Transcaucasie occid., Gouv. Kutais, Artvin, 1 [[ worker ]], 23. VI. 1898 (Derjugin!).

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Transcaucasie orient., Gouv. Baku, gorge de Bum, 3 [[ queen ]], 1892 (Schelkovnikovi).

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fn. Suec. 1722. Latr. Fourm. 159, pl. VI, fig. 32. [[ worker ]] [[ queen ]] [[ male ]]. Fabr. Piez. 392, 13. Hueber Rech. Fourm, pl. 2, fig. 8, 9, 10, [[ queen ]] [[ worker ]] [[ male ]]. Zett. Ins. Lapp. 448, 4. Lepel. S: t Farg. Hymen. 205, 6. Dahlb. mscrpt.

 

Femina: fusco-nigra nitida cinereo-micans, mandibulis rufescenlibus, antennarum scapis pedibusque ferrugineo-lestaceis; alis albo-hyalinis, nervis et stigmate fuscis; squama lata triaugulariter subrotundata; abdomine polito, subnudo.

 

Mas: fusco-niger nitidus cinereo-micans, antennarum scapis saepissime et pedibus genitalibusque testaceo-flavescentibus; squama crassa subquadrata; supra concaviuscula.

 

Habitare videtur in omnibus regiqnibus Europae. In Fennia occurrunt mares teminaeque sub m. Junio et Julio parcius.

 

[[ worker ]]. (Operariam hujus hucusque ab operaria prascedentis notis positivis distinguere haud valeo, nec conjecturas audeo, quando eam numquam simul cum femina in nido observavi; determinado igitur omnis differenda, donec melius docuerit experientia).

 

[[ queen ]]. Long. 3 1 / 2 lin. Simillima [[ queen ]] praecedentis, tamen sequentibus notis distincta. Magnitudo paullo major. Caput et thorax dense subtiliter adpresse cinereo-pubescentia, micantia. Occiput thoracis latitudine. Antennae scapis et basibus flagellorum testaceo-ferrugineis. Alas albo-hyalinae, nervis et stigmate fuscis, radice et tegula testaceis nitidis; alae anticae 3 1 / 2 lin. longae. Prothoracis margo pleuralis et sternalis rufescens. Pedes pallide testaceo-ferruginei, coxis prater apicem fuscis. Abdomen nitidissimum subaenescens, thorace paulo longius ovale, latius et depressius quam in procedente, segmento tertio latiori quam secundo, multo latiori quam quarto; segmentis omnibus subtilissime sparse adpresse cinereo-pubescentibus, basibus late nudis politis, apicibus praesertim in lateribus et ventre membranaceo-pallescentibus; segmentum secundum ad basin supra utrinque trausversum obsolete impressum; anus summus rufescens.

 

[[ male ]]. Long. 3 1 / 2 lin. habitu similis feminae, formatione partium apud mares in hac subdivisione solita. Mandibula; apice rufescentes. Oculi prominuli nudi; ocelli in prominentia obsoleta verticis. Antennae scapis vel pallide testaceis vel obscuris. Thorax tamquam caput sericeo-micans. Alae ut in [[ worker ]], interdum obsoletissime fuscescentes; anticae long. 3 lin. Pedes pallide testacei coxis plus minus fuscis et articulo tarsorum ultimo parum obscuro. Abdomen sericeo nitens paulum subaenescens, interdum brunnescens, marginibus segmentorum certo situ cinerascenti-membranaceis. Genitalia cum valvula ventrali flavidopilosula, pallide testacea.

License not applicable

Nylander, W.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Formica fusca, Linn. Faun. Suec. no. 1722.

 

Hab. Europe and North America.

License not applicable

Smith, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Formica fusca, Linn. Faun. Suec. 226.1722; Syst. Nat. i. 963.4.

 

Fabr. Ent. Syst. ii. 352. 11; Syst. Piez. 399.13.

 

Schrank, Ins. Austr. 413.

 

Latr. Hist. Nat. Fourm. 159. pl. 6. f. 32. A. [[worker]]. E. [[male]].

 

Oliv. Encycl. Meth. vi. 493.13.

 

Huber,.Rech. Fourm. t. 2. f. 8, 9, 10.

 

Zett. Ins. Lapp. 448.

 

Brulle, Hist. Nat. II. Canar. iii. 84. 3.

 

Losana, Form. Piem. 317.

 

St. Farg. Hym. i. 205. 6. Nyt. Adno. Mon. Form. Bor. 919. 15; Addit. Alter. 30;

 

Form. Fr. et d'Alger. 65. 20.

 

Schenck, Beschr. Nass. Ameis. 43.

 

Smith, Brit. Form. 104. 4.

 

Mayr. Form. Austr. 74.17; Ungar. Ameis. 11. 16.

 

Formica glebaria , Nyl. Adno. Mon. Form. Bor. 917.14.

 

Foerst. Hym. Stud. Form. 31. 13.

 

Hab. Britain; France; Germany; Austria; Hungary; Finland; Madeira.

License not applicable

Smith, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lin. System, nat. ed. 12, tom. 1. pag. 963,. 4, -Faun. Suec. ed. 2, n\ 1722, et ed. 1. n\ 1021. - Form. nigra Latr. p. 156. [[ worker ]] [[queen]] [[male]]. - Lep. de St. Farg. Hym. 206, 7. - Nyl. Adn. p. 920, 16.

 

Operaria: Fusca tota, cineraseenti-micaas, nitida, sparse flavido-pilosula, anteanarom scapis pedibusque(praeter pubescentiam adpressam), tenuissime alho-pilosulis; mandibulis rufis confertim rugosis, punetatis; elypeo subtiliter ruguloso, foveolis lateralibus laevibus; area frontali subtilissime punctulata, subnitida; squama subrectangulari, supra parum vel vis emarginata. Lg. 1-IV, lin.

 

Femina: Fusco-nigrescens, dense undique cinereo-micans, nitida, mandibulis, antennarum scapo cum pedicello obscure rufescenUbus, pedum articulationibus tarsisque ferrugineo-pallescentibus; mandibulis confertim rugosis, fortiter punetatis; clypeo subtiliter ruguloso foveolis lateralibus Iaevibus; area frontali subtilissime punctulata, nitida; alis albo-hyalinis, nervis et stigmate pallide flavidis, subradio fusco; squama verticaliter subrectangulari, supra angulis rotundatis et medio subangulatim emarginato. Lg. 3 1/2 lin.

 

Mas: Fusco-niger, parum cinereo-micans, nitidus, antennarnm flagellis fuscescentibus tarsisque obscure pallescentibus, (Ulis articulo primo crassiusculo); clypeo cum area frontali subrugulosis, subopacis; alis albo-hyalinis, nervis et stigmate pallide flavidis; squama exigua subrectangulari, supra parum coneaviuscula. Lg. 1 3/4-2 lin.

 

Die Art, welche ich hier als F. fusca L. aufstelle, wird von Latreille und sicherlich gestützt auf dessen Autorität auch von Nylander als F. nigra L. gedeutet, aber wie mir scheint, mit Unrecht,* denn Linne's Diagnose, welche er von seiner fusca aufstellt, pafst auf vorstehende Art doch besser als die, welche er für die Form nigra angibt, nämlich : tota nigra, nitida, tibiis oinerascentibus. Der Name fusca pafst auch für die hier bezeichnete Art weit besser als der von Latr. und Nyl. gebrauchte. Der letztere Schriftsteller bezeichnete auch seine nigra (unsre fusca ) nicht mit dieser Farbe in der Diagnose, sondern er braucht den Ausdruck fusco-nigrescens,oder fusco-niger, was uns in unsrer Ansicht noch bestärkenmuß . Als Form. fusca finde ich unsre Art auch in der Neesischen Sammlung und sie wurde mir yon verschiedenen Seiten unter diesem Namen zugesendet.

 

Der Arbeiter dieser Art hat eine braune Grundfarbe, welche am Mittelleib mehr oder weniger röthlich durchscheint, die Mandibeln, der Schaft mit dem Stielchen, mitunter auch die Geißel sind an der Basis mehr oder weniger roth, die Tarsen etwas heller röthlichgefärbt . Der ganze Körper ist sehr fein runzlig, mit einer bräunlich-grauen , anliegenden Pubescenz dicht bedeckt und mit gelblichen Borstenhaaren bekleidet, welche an dem Fühlerschaft und den Beinen etwas feiner und mehr weißlich erscheinen. Die Mandibeln dicht längsrunzlig , ziemlich deutlich punktirt, der Clypeus schwach runzlig mit glatten Seitengruben; das Stirnfeld äußerst fein punktirt, glänzend ; die Stirnrinne sehr fein und vor den Nebenaugen abbrechend. Die Augen fast kahl, die Nebenaugen sehr klein. Der Mittelleib bräunlich , etwas röthlich durchscheinend, der Hinterbrustruecken an der abschüssigen Stelle viel länger als an dem Basaltheil, regelmäßsig dreiseitig, oben spitz, sehr stark glänzend , nur der Rand überall fein punktirt, matt. Die Beine braun, die Trochanteren, die Kniee, die Spitze der Schienen und die Tarsen röthlich . Die Schuppe fast rechtwinklig, oben sehr wenig oder kaum ausgerandet, schwach gewimpert, der Hinterleib braun, dicht mit anliegenden, graubraunen Härchen bedeckt, und reichlich mit abstehenden, längeren Borstenhaaren versehen.

 

Das Weibchen zeichnet sich von dem Arbeiter gleich durch seine bedeutende Größe aus, es ist tiefer braun gefärbt , schwärzlich , hat dieselbe Sculptur und Pubescenz wie der Arbeiter, und dieselben Borstenhaare. Die Mandibeln sind roth, nicht so dicht aber stärker runzlig und stärker punktirt als bei dem Arbeiter. Der Clypeus kaum runzlig, aber in der Mitte deutlich punktirt, die Seitengruben glatt; das Stirnfeld mit wenigen, äußerst schwachen Pünktchen , glänzend ; die Stirnrinne geht bis zu den Nebenaugen durch; die Augen kurzhaarig, die Nebenaugen groß . An den Fühlern der Schaft und das Stielchen roth, letzteres mitunter mehr oder weniger bräunlich . Am Mittelleib der Mittelbrustrücken sammt dem Schildchen schwächer runzlig, daher mehr glänzend ; der Hinterbrustrücken dagegen in der Mitte fast von der Basis an völlig glatt und sehr stark glänzend . Die Flügel wasserhell, die Adern und das Randmal gelblich; alle Längsadern an der Basis, die Unterrandader sogar bis zum Randmal hinauf bräunlich . Die Isle Diskoidalzelle mehr oder weniger fast kubisch, oder oben stark 2/3 der Basalbreite betragend. Die Beine braun mit röthlichen Tarsen, auch die Tibien schimmern röthlich-durch . Die Schuppe von oben gesehen fast rechtwinklig, die Winkel oben zugerundet, in der Mitte ziemlich tief, faßt winklig ausgerandet und ringsum gewimpert. Der Hinterleib verhältnißtnäßig sehr großs , breiter als der Mittelleib, die Pubescenz äußerst dicht.

 

Das Männchen ist wieder im Verhältniß zu dem Weibchen sehr klein und übertrifft den Arbeiter nur wenig an Größe , die Färbung ist indeß mehr schwarzbraun, die Pubescenz auf Kopf und Thorax weniger dicht, und der letztre auch nur mit zerstreuten, kürzeren Borstenhaaren. Die einzähnigen Mandibeln sind fein runzlig, der Clypeus und das Stirnfeld ebenso, letzteres fast glanzlos. Die Stirnrinne tief, bis zu den Nebenaugen hinaußteigend , die sehr groß sind; die Netzaugen sehr kurz und spärlich behaart. Der Fühlerschaft braun, die Fühler- schmutzig gelb, oder gelbbräunlich , das Stielchen an der Spitze kugelig-verdickt. Der Mittelleib um das Schildchen herum gewöhnlich schwach röthlich durchscheinend, die abschüssige Stelle des Hinterrückens in der Mitte glatt und glänzend . Die Flügel wasserhell, die Adern und das Randmal gelblich, die Längsadern an der Basis, die Unterrandader zwar etwas mehr als die übrigen aber doch bei weitem nicht bis zum Randmal hinauf sehwach bräunlich . Die Beine braun, die Tarsen nach der Spitze allmählig mehr röthlich . An den Beinen sowohl wie am Schaft finden sich nur sehr wenige, zerstreute und nicht leicht in die Augen fallende, feine Borstenhaare. Die Schuppe klein mit langen Wimperhaaren, oben entweder etwas eingedrückt , oder breit und scwach ausgerandet. Am Hinterleib ist die Pubescenz stärker als andern Mittelleib, die Borstenhaare stehen gedrängter und dichter und sind länger . Die äußeren Genitalklappen sind besonders langborstig.

 

Diese Art ist in hiesiger Gegend sehr verbreitet, der Arbeiter besonders häufig in Gärten und man möchte sagen auf allen Pflanzen anzutreffen. Nach Latr. ist es auch die häufigste Art in Frankreich, nach Nyl. geht sie bis nach Lappland hinauf, und ist also auch im höchsten Norden noch zu finden. Sie lebt unter Steinen, macht aber auch selbständige , kleine Erdhaufen nach Art der Form. flava . Ihre Kolonieen sind meist sehr bevölkert . In sandigen Gegenden macht sie an der Oberfläche oft lange, verdeckte Gänge , die man an der staubartigen, pulverigen Masse leicht erkennen kann. Ihre Lebensweise ist noch wenig erforscht.

License not applicable

Förster, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Formica fusca, Linn . Faun. Suec. 1722. Nyland. Adno. Mon. Form. Boreal. 919, 15.

License not applicable

Smith, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Formica fusca, Linn . Faun. Suec. 1722. De Geer, Ins. ii. 1082, 3,

 

t. 42, f. 12, 15. Schrank, Ins. Aust. 413, 833. Oliv. Enc.

 

Meth. vi. 433. Fab. Ent. Syst. ii. 352, 11. Latr. Hist. Nat.

 

Fourm. 159, t. 6, f. 32. Jurine, Hym. 272. St. Farg. Hist.

 

Nat. Ins. 205, 6. Zett. Ins. Lapp. 448,4. Formica libera, Scop . Ent. Carn. 313, 835. Formica nigra, Christ . 510, t. 60, f. 6. [[ male ]] La Fourmi toute brune, Geoff. Ins. Par. ii. 428, 5. Huber, Fourm. 322, t. 2, f. 8,9,10.

 

Hab. - Britain, Banks.

License not applicable

Smith, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

Flowering Plants Visited by Formica fusca in Illinois

Formica fusca Linnaeus: Formicidae (Formicinae), Hymenoptera
(observations are from Robertson, Graenicher, and Krannitz & Maun; this is an ant)

Apiaceae: Cicuta maculata sn (Rb); Bignoniaceae: Campsis radicans [exfl sn fq] (Rb); Caesalpiniaceae: Chamaecrista fasciculata [exfl sn] (Rb); Caprifoliaceae: Viburnum opulus (KM); Fabaceae: Strophostyles helvola [exfl sn fq] (Rb); Grossulariaceae: Ribes cynosbati sn np (Gr); Liliaceae: Tofieldia glutinosa sn (Gr); Rosaceae: Prunus serotina [exfl sn] (Rb)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Animal / guest
larva of Clytra laeviuscula is a guest in nest of Formica fusca

In Great Britain and/or Ireland:
Animal / parasite
Formica exsecta parasitises nest (queenless) of Formica fusca

Animal / parasite
queen (newly mated) of Formica rufa parasitises nest of Formica fusca
Other: minor host/prey

Animal / predator
adult of Formica sanguinea is predator of brood of Formica fusca

Animal / predator
larva of Microdon mutabilis is predator of pupa of Formica fusca

Animal / associate
adult of Systellonotus triguttatus is associated with Formica fusca
Remarks: season: late 5-mid 8

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Formica fusca preys on:
Dilachnus pini

Based on studies in:
England, Oxshott Heath (Heath, Plant substrate)

This list may not be complete but is based on published studies.
  • O. W. Richards, 1926. Studies on the ecology of English heaths III. Animal communities of the felling and burn successions at Oxshott Heath, Surrey. J. Ecol. 14:244-281, from pp. 263-64.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Formica fusca sp. 3

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Formica fusca

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATAATTATTCGCTTAGAATTAGGCTCATCAAATTCATTAATCAATAAT---GATCAAATTTATAATTCTTTAGTAACTAATCACGCTTTTATCATAATTTTTTTCATAGTAATGCCATTTATAATTGGTGGATTTGGAAATTTTCTAATTCCCTTAATA---CTAGGATCTCCAGACATAGCTTATCCTCGTATAAATAATATAAGATTTTGACTCTTACCACCTTCAATTACTCTTTTACTTTTAAGAAATTTTATTAATGATGGCACAGGTACAGGATGAACTATCTATCCTCCCTTAGCTTCAAATATTTTTCATAACGGTCCTTCTGTAGACTTA---ACAATTTTTTCCCTACATATTGCAGGTATATCCTCAATTTTAGGAGCAATTAATTTTATTTCAACAATTCTTAATATACATCATAAAAATTTTTCTATTGATAAAATTCCTTTACTAGTATGATCAATTTTAATCACAGCTATCTTACTTCTATTATCCTTACCTGTTTTAGCCGGA---GCTATTACTATACTATTAACTGATCGAAATTTAAATACTTCATTTTTTGATCCTTCAGGAGGGGGCGATCCAATTCTATACCAACATTTATTTTGATTTTTTGGTCATCCCGAAGTTTATATTTTAATTTTACCAGGATTTGGATTAATTTCCCATATTATTATAAACGAAAGAGGAAAAAAA---GAAACTTTTGGAGCTTTAGGAATAATTTATGCTCTTATAGCAATTGGATTCTTAGGATTTGTTGTCTGAGCTCATCATATATTTACAATCGGTTTAGATGTTGATACACGAGCATATTTTACTTCCGCAACTATAATTATTGCTATCCCTACTGGAATTAAAATTTTTAGATGAATTACA---ACTTTACATGGAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Formica fusca

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 72
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Formica fusca group

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Formica fusca complex

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 335
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Formica fusca

Formica fusca, a common black colored ant found in Europe, is a palaearctic ant with a range extending from Portugal in the west to Japan in the east and from Italy in the south to Fennoscandia in the north. F. fusca nests are usually found in rotten tree stumps or under stones in clearcut areas and along woodland borders and hedgerows.[citation needed]

Colonies are facultatively polygynous (though weakly so); though the queens coexist amicably, contribution to the brood tends to be unequal. Nests are usually small, containing 500–2,000 workers. The workers are large, at 8–10 millimetres (0.3–0.4 in) long, and fast moving, though timid. To ensure that non-nest mate eggs are not reared, these workers will engage in a process known as worker policing.[citation needed]

F. fusca feeds on small insects, aphid honeydew and extra floral nectaries. Alate (winged) forms are produced in June/July and nuptial flights are in July/August.[citation needed]

Workers have been found to have a very high resistance to some pathogens[1] and it is thought this may be due to F.fusca utilising the antibiotic properties of their formic acid, additional to the use of their metapleural gland.[citation needed]

A recent study has found evidence of nepotism in F. fusca,[2] in contrast with previous experiments with other ant species;[3] this conclusion has been challenged, however, on the grounds that the observed pattern may result from differences in egg viability.[4]

References[edit]

  1. ^ Graystock, Peter; Hughes, William O. H. (2011). "Disease resistance in a weaver ant, Polyrhachis dives, and the role of antibiotic-producing glands". Behavioral Ecology and Sociobiology. doi:10.1007/s00265-011-1242-y. 
  2. ^ Hannonen, M. and Sundström, L. (2003) Worker nepotism among polygynous ants. Nature, 421:910.
  3. ^ Snyder, L. (1993) Non-random behavioural interactions among genetic subgroups in a polygynous ant. Animal Behavior, 46:431-439.
  4. ^ Fournier, D., Aron, S. & Keller, L. (2004) Significant reproductive skew in the facultatively polygynous ant Pheidole pallidula. Molecular Ecology, 13:203-210.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!