Articles on this page are available in 1 other language: French (3) (learn more)

Overview

Brief Summary

Overview

  Lasius alienus is a dull brown species with lighter brown appendages, dense pubescence, and a truncated propodeum. Under the current taxonomic concept (Seifert, 1992; Wilson, 1955), L. alienus has one of the most widespread native ranges of any ant species, spanning the Holarctic from the west to east coast of North America through Western Europe and Central Asia east to Japan. Whether these widely separated populations truly represent a single species or are actually a complex of cryptic species is a question of some debate (Seifert, 1992;2009). The bi-continental distribution, perhaps together with the unfortunate specific epithet, has caused led some to consider L. alienus an alien species in North America (Maerz et al., 2009; McGlynn, 1999a). While the North American population may well prove to be a species distinct from the Eurasian populations, the preferred habitats, broad distribution and general biology suggest that its occurrence on the continent preceded the arrival of humans. The ants are monogynous, eat both dead and live insects, gather nectar from the floral and extrafloral nectaries of plants, tend honeydew-excreting insects, and foster and transport certain subterranean plant lice from the roots of one plant to another. These latter habits cause L. alienus to sometimes be considered an agricultural pest (Smith, 1965). The species is also considered a house pest in some areas, as it is tends agricultural pests and is prone to enter dwellings in search of food and shelter (Smith, 1965; Thompson, 1990). The name ‘Cornfield Ant’ is sometimes applied to Lasius species, including L. alienus, but its use is perhaps better confined to L. neoniger which was discovered to have a mutualistic relationship with corn root aphids. 

 
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Taxonomic History

Taxonomic history

Status as species: Saunders, 1880 PDF: 209; André, 1882b: 192; Nasonov, 1889: 22; Emery, 1897g: 238; Ruzsky, 1902d: 16; Strongylognathus huberi For., subsp. rehbinderi For., var. cecconii Emery, nova varietas.]. P. 24 in: Cecconi, G. 1908. Contributo alla fauna delle Isole Tremiti. Bollettino dei Musei di Zoologia ed Anatomia Comparata della Reale Università di Torino 23(583):1-53. [1908-05-20] [1908-05-20]">Emery, 1908e: 24; Bondroit, 1911a PDF: 11; Donisthorpe, 1915f: 212; Bondroit, 1918 PDF: 25; Stitz, 1939: 279; Novák & Sadil, 1941 PDF: 101; Röszler, 1942a: 53; Stärcke, 1944b PDF: 153; Wilson, 1955a PDF: 77; Baroni Urbani, 1971c PDF: 200; Kutter, 1977c: 227; Collingwood, 1979 PDF: 97; Yamauchi, 1979 PDF: 156; Collingwood, 1982 PDF: 285; Kupyanskaya, 1990a: 218; Atanassov & Dlussky, 1992: 237; Seifert, 1992b: 13.
Senior synonym of Lasius americanus, Lasius pannonica and material of the unavailable names Lasius alienoamericanus, Lasius flavidus, Lasius turkmenus referred here: Wilson, 1955a PDF: 77.
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

  It is well recognized that the ecology of the North American and Eurasian populations of L. alienus differ considerably. In the Central Europe L. alienus is found in xerothermous, non-urban habitats of differing horizontal and vertical plant structure such as bare rocky areas, dense grasslands, orchards, sunny forest margins or warm woodlands with sparse canopy cover (Seifert, 1992). In North America alienus prefers well shaded woodland, where it nests in rotting logs and stumps and under stones (Wilson, 1955). Wilson argued that the ecological differences between the two populations were caused by competition with the congeneric species, but Seifert believes the North American population is a distinct species (pers. comm.). 

 
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lasius alienus is a dull brown species with lighter brown appendages, dense pubescence, and a truncated propodeum. Under the current taxonomic concept (Seifert, 1992; Wilson, 1955), L. alienus has one of the most widespread native ranges of any ant species, spanning the Holarctic from the west to east coast of North America through Western Europe and Central Asia east to Japan. Whether these widely separated populations truly represent a single species or are actually a complex of cryptic species is a question of some debate (Seifert, 1992;2009). The bi-continental distribution, perhaps together with the unfortunate specific epithet, has caused led some to consider L. alienus an alien species in North America (Maerz et al., 2009; McGlynn, 1999a). While the North American population may well prove to be a species distinct from the Eurasian populations, the preferred habitats, broad distribution and general biology suggest that its occurrence on the continent preceded the arrival of humans. The ants are monogynous, eat both dead and live insects, gather nectar from the floral and extrafloral nectaries of plants, tend honeydew-excreting insects, and foster and transport certain subterranean plant lice from the roots of one plant to another. These latter habits cause L. alienus to sometimes be considered an agricultural pest (Smith, 1965). The species is also considered a house pest in some areas, as it is tends agricultural pests and is prone to enter dwellings in search of food and shelter (Smith, 1965; Thompson, 1990). The name ‘Cornfield Ant’ is sometimes applied to Lasius species, including L. alienus, but its use is perhaps better confined to L. neoniger which was discovered to have a mutualistic relationship with corn root aphids. 

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Antkey

Source: Antkey

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

34 . Lasius alienus HNS (Forster, 1850)

Figs. 128-130.

Formica aliena Forster HNS , 1850:36.

Worker. Greyish yellow to brownish black. Pubescence adpressed, moderately thick over whole body and appendages. Short erect hairs scattered over dorsum and round whole occipital margin of head. Back of head convex. Ocelli indistinct or invisible; frontal furrow indistinct. Erect hairs absent on scape and front tibiae, sometimes present on hind tibiae. Length: 3.0-4.2 mm.

Figs. 128-130. Lasius alienus (Forster) HNS . - 128: head and alitrunk of queen in profile; 129: male in profile; 130: head of worker in dorsal view. Scale: 1 mm.

Figs. 131, 132. Lasius brunneus (Latr.) HNS . - 131: head of worker in dorsal view; 132: head of male in dorsal view. Scale: 1 mm.

Queen . Greyish black to brownish black. Wings hyaline. Head much narrower than broad alitrunk. Pubescence and pilosity as in worker, no erect hairs on scape and front tibiae. Length: 8.0-9.0 mm.

Male. Greyish black. Wings hyaline. No erect hairs on tibiae or scapes. Length: 3.0-3.8 mm.

Distribution. Common in Denmark and South Sweden; in Norway only recorded from. O, HE and VE; in Finland recorded as far north as Ob and Ks. - Common in South Britain, local in Ireland and Southwest Scotland. - Range: Portugal to Japan also Himalayas, North Africa to Finland. Also North America (Wilson, 1955).

Biology. This wide ranging species nests in the soil on sandy lowland heaths, dry open pasture, sea cliffs and rocky outcrops in North Europe. Its habits are mainly subterranean, feeding on the exudates of root aphids but also by scavenging and predating small insects. Workers are generally unobtrusive and non aggressive compared with Lasius niger HNS . Nests are single queened founded by solitary fertilised queens. Mating swarms occur in August.

  • Collingwood, C. A. (1979): The Formicidae (Hymenoptera) of Fennoscandia and Denmark. Fauna Entomologica Scandinavica 8, 1-174: 97-98, URL:http://antbase.org/ants/publications/6175/6175.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lasius alienus HNS ( Förster , 1850)

Northwest Iran.

Det. Ward, Collingwood or Munsee

CRAWLEY (1920b), ARDEH (1994), HMIM

  • Paknia, O., Radchenko, A., Alipanah, H. (2008): A preliminary checklist of the ants (Hymenoptera: Formicidae) of Iran. Myrmecologische Nachrichten 11, 151-159: 155-155, URL:http://antbase.org/ants/publications/21820/21820.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lasius alienus (Foerster HNS 1850a)

  • Ward, P. S. (2005): A synoptic review of the ants of California (Hymenoptera: Formicidae). Zootaxa 936, 1-68: null, URL:http://antbase.org/ants/publications/21008/21008.pdf
Public Domain

Ward, P. S.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wilson (1955)described the full distribution of L. alienus, stating, “In Eurasia it is found from the British Isles and southern Fennoscandia south to Morocco-Tunisia, east through Lebanon and Iraq to Kashmir and southern China, and north into European Russia, central Asia, China, and Japan. Unlike [Lasius] niger, it apparently does not occur in the Balearics, Canaries, and Azores, or in Formosa. In North America it is found from southern British Columbia to Nova Scotia and south to the mountains of Durango, Mexico, in the west, and to northern Florida in the east.”


It is well recognized that the ecology of the North American and Eurasian populations of L. alienus differ considerably. In the Central Europe L. alienus is found in xerothermous, non-urban habitats of differing horizontal and vertical plant structure such as bare rocky areas, dense grasslands, orchards, sunny forest margins or warm woodlands with sparse canopy cover (Seifert, 1992). In North America alienus prefers well shaded woodland, where it nests in rotting logs and stumps and under stones (Wilson, 1955). Wilson argued that the ecological differences between the two populations were caused by competition with the congeneric species, but Seifert believes the North American population is a distinct species (pers. comm.). 

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Antkey

Source: Antkey

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current range (Wilson, 1955): In Eurasia it is found from the British Isles and southern Fennoscandia south to Morocco-Tunisia, east through Lebanon and Iraq to Kashmir and southern China, and north into European Russia, central Asia, China, and Japan. Does not occur in the Balearics, Canaries, and Azores, or in Formosa. In North America it is found from southern British Columbia to Nova Scotia and south to the mountains of Durango, Mexico, in the west, and to northern Florida in the east.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Antkey

Source: Antkey

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

  Current range (Wilson, 1955): In Eurasia it is found from the British Isles and southern Fennoscandia south to Morocco-Tunisia, east through Lebanon and Iraq to Kashmir and southern China, and north into European Russia, central Asia, China, and Japan. Does not occur in the Balearics, Canaries, and Azores, or in Formosa. In North America it is found from southern British Columbia to Nova Scotia and south to the mountains of Durango, Mexico, in the west, and to northern Florida in the east.

 
 

  Throughout SLO except S & NE

 
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Taxonomic Treatment

Forel, A., 1890:
  Laverdure (sur les chênes-liège ); Bône .
 

Ward, P. S., 2005:
 

Andre, E., 1887:
 Ouvriere: Antennes de 9 articles. Tout le corps lisse et tres luisant. D'un brun-marron fonce, presque noir; mandibules et partie anterieure de la tete plus rougeatres; antennes, articulations des pattes et tarses d'un jaune sale. Pubescence nulle; pilosite tres eparse; funicule avec une pubescence un peu relevee et assez abondante. Pronotum et mesonotum formant ensemble (vus en dessus) un hemisphere un peu aplati; mesonotum separe du metanotum par un profond etranglement; face basale du metanotum horizontale, au moins aussi longue que sa face declive. Ecaille cuneiforme, un peu inclinee en avant, tres epaisse a la base, amincie et plus ou moins echancree au sommet. - Long., 1 2 / 3 - 2 mill.
 Cuba.
  Parait etre voisine de la M. Kraatzi Roger , qui ne m'est connue que par la description de son auteur, mais s'en eloigne par sa couleur tout autre et par la conformation de son petiole.
 

Forel, A., 1894:
 Himalaya, 9,000 ' de hauteur (M. Smythies). [[ queen ]] L. 2, 7 a 3, 2 mill. Pas de sillon frontal distinct. Brunatre, avec le thorax les antennes et les pattes plus clairs. Scapes et pattes sans poils dresses. Comme les petits exemplaires clairs d'Europe.
 
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Identification

  Diagnosis among workers of introduced and commonly intercepted ants in the United States. Worker caste monomorphic. Antenna 12-segmented. Antennal club indistinct. Antennal scape length less than 1.5x head length. Eyes medium-sized (greater than 5 facets). Three distinct ocelli present. Mandibles with 8 (rarely 9) teeth including 3 basal teeth. Promesonotum separated from propodeum by metanotal groove, but not by a deep and broad concavity. Propodeum and petiolar node both lack a pair of short teeth. Propodeum lacking posteriorly projecting protrusion. Propodeal declivity at least twice length of propodeal dorsum. Metapleuron with a distinct gland orifice. Waist 1-segmented. Petiole upright and not appearing flattened. Gaster armed with acidopore. Distinct constriction not visible between abdominal segments 3+4. Erect hairs present on mesosoma, but not long thick and produced in pairs. Head length = 0.75–0.97 mm. Head width = 0.68–0.92 mm. Scape length = 0.72–0.89 mm.

 

  Lasius alienus specimens from Europe, which are commonly intercepted at US ports of entry, cannot be distinguished from North American specimens using any current methods. The species can be separated from introduced and other commonly intercepted formicine genera by the combination of the following characters: (1) antenna 12-segmented; (2) monomorphic worker caste; (3) three distinct ocelli; (4) metapleural gland present; and (5) propodeal declivity at least twice length of propodeal dorsum. Separating L. alienus from the invasive L. neglectus (which is at risk of establishing in North America) is difficult. The mandibles of L. alienus have eight (or rarely nine) teeth, three of which are basal (versus seven or rarely eight teeth, two of which are basal in L. neglectus).  Lasius alienus is also relatively larger (HW = 0.68–0.92 mm, versus 0.64–0.81 mm in L. neglectus), with generally longer antennal scapes (SL = 0.72–0.89 mm, versus 0.68–80 mm in L. neglectus). Lastly, L. alienus is monogynous while L. neglectus is polygynous. Additional morphometric characters used to separate the two species are available in Seifert (1992)and partially summarized in Espadaler & Bernal (2004), but beware that these characters are averaged across workers of entire colonies.

 
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnosis of worker among Antkey species. Worker caste monomorphic. Antenna 12-segmented. Antennal club indistinct. Antennal scape length less than 1.5x head length. Eyes medium-sized (greater than 6 facets). Three distinct ocelli present. Mandibles with 8 (rarely 9) teeth including 3 basal teeth. Promesonotum separated from propodeum by metanotal groove, but not by a deep and broad concavity. Propodeum and petiolar node both lack a pair of short teeth. Propodeum lacking posteriorly projecting protrusion. Propodeal declivity at least twice length of propodeal dorsum. Metapleuron with a distinct gland orifice. Waist 1-segmented. Petiole upright and not appearing flattened. Gaster armed with acidopore. Distinct constriction not visible between abdominal segments 3+4. Erect hairs present on mesosoma, but not long thick and produced in pairs. Head length = 0.75–0.97 mm. Head width = 0.68–0.92 mm. Scape length = 0.72–0.89 mm.


Lasius alienus specimens from Europe, which are commonly intercepted at US ports of entry, cannot be distinguished from North American specimens using any current methods. The species can be separated from introduced and other commonly intercepted formicine genera by the combination of the following characters: (1) antenna 12-segmented; (2) monomorphic worker caste; (3) three distinct ocelli; (4) metapleural gland present; and (5) propodeal declivity at least twice length of propodeal dorsum. Separating L. alienus from the invasive L. neglectus (which is at risk of establishing in North America) is difficult. The mandibles of L. alienus have eight (or rarely nine) teeth, three of which are basal (versus seven or rarely eight teeth, two of which are basal in L. neglectus). Lasius alienus is also relatively larger (HW = 0.68–0.92 mm, versus 0.64–0.81 mm in L. neglectus), with generally longer antennal scapes (SL = 0.72–0.89 mm, versus 0.68–80 mm in L. neglectus). Lastly, L. alienus is monogynous while L. neglectus is polygynous. Additional morphometric characters used to separate the two species are available in Seifert (1992)and summarized in Espadaler & Bernal (2004), but beware that these characters are averaged across workers of entire colonies.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Antkey

Source: Antkey

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Records

 

(Map 50): Bulgaria ( Agosti and Collingwood 1987a , Atanassov and Dlusskij 1992 , Seifert 1992 ); Western Predbalkan: Rachene river valley ( Vassilev 1984 ); Western Stara Planina Mts: Lakatnik station (Vratsa district) ( Atanassov 1936 ); Konyavska Planina Mt.: Uglyartsi vill. ( Lapeva-Gjonova 2004b ); Sofia Basin: Sofia ( Forel 1892 , Lapeva-Gjonova and Atanasova 2004 , Antonova 2004 , 2005 , Antonova and Penev 2006 , Hlaváč et al. 2007 ), the surroundings of Sofia near Vladaya vill. ( Antonova and Penev 2006 , 2008 ); Vitosha Mt. ( Atanassov 1936 , 1952 , Hlaváč et al. 2007 ): Knyazhevo ( Forel 1892 ); Plana Mt.: Pasarel vill. ( Hlaváč et al. 2007 , Vagalinski and Lapeva-Gjonova in press ); Tsiganka peak (Pasarel vill.), Bukov dol loc. (Pasarel vill.), Plana vill., Peyova buka hut (Pasarel vill.), Alino vill. ( Vagalinski and Lapeva-Gjonova in press ); Lozenska Planina Mt. ( Vassilev and Evtimov 1973 ): near German monastery ( Antonova and Penev 2008 ); Bakadzhik-Burgas district: Aytos ( Forel 1892 ); Strandzha Mt. ( Antonova et al. in press ); Krupnik-Sandanski- Petrich Valley: along Strumeshnitsa river ( Atanassov 1964 ); Belasitsa Mt. ( Atanassov 1964 ); Rila Mt.: Rila monastery, the valley of Rilska river ( Forel 1892 ); Western Rhodopi Mts: Chepintsi vill., Arda vill., Koshnitsa vill. ( Hlaváč et al. 2007 ), Dospat, Smolyan, Rakitovo, Velingrad, Chepelare ( Lapeva-Gjonova in press (a) ); Eastern Rhodopi Mts: Kokiche vill. (Kardzhali), Dedets vill. (Zlatograd), Dyadovtsi vill. (Ardino), Madzharovo, Zvezdel vill. (Momchilgrad), between Dabovets vill. and Kamilski dol vill. (Ivaylovgrad), between Odrintsi vill. and Svirachi vill. (Ivaylovgrad), Svirachi vill. (Ivaylovgrad), Zhelezino vill. (Ivaylovgrad), Meden buk vill. (Ivaylovgrad) ( Lapeva-Gjonova 2004a ); Northern Black Sea coast: Evksinograd palace ( Atanassov 1936 ); Southern Black Sea coast: Veselie vill. ( Forel 1892 ).

 

Notes:

 

Seifert (1992) has divided the former " Lasius alienus " into several species, three of which are found in Bulgaria: Lasius alienus , Lasius paralienus and Lasius psammophilus . Consequently, records of Lasius alienus in all papers before 1992 may refer to any of these species.

License not applicable

Lapeva-Gjonova, Albena

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Laverdure (sur les chênes-liège ); Bône .

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Himalaya, 9,000 ' de hauteur (M. Smythies). [[ queen ]] L. 2, 7 a 3, 2 mill. Pas de sillon frontal distinct. Brunatre, avec le thorax les antennes et les pattes plus clairs. Scapes et pattes sans poils dresses. Comme les petits exemplaires clairs d'Europe.

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ouvriere: Antennes de 9 articles. Tout le corps lisse et tres luisant. D'un brun-marron fonce, presque noir; mandibules et partie anterieure de la tete plus rougeatres; antennes, articulations des pattes et tarses d'un jaune sale. Pubescence nulle; pilosite tres eparse; funicule avec une pubescence un peu relevee et assez abondante. Pronotum et mesonotum formant ensemble (vus en dessus) un hemisphere un peu aplati; mesonotum separe du metanotum par un profond etranglement; face basale du metanotum horizontale, au moins aussi longue que sa face declive. Ecaille cuneiforme, un peu inclinee en avant, tres epaisse a la base, amincie et plus ou moins echancree au sommet. - Long., 1 2 / 3 - 2 mill.

 

Cuba.

 

Parait etre voisine de la M. Kraatzi Roger , qui ne m'est connue que par la description de son auteur, mais s'en eloigne par sa couleur tout autre et par la conformation de son petiole.

License not applicable

André, E.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

Lasius neglectus

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Antkey

Source: Antkey

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

Animal / guest
larva of Clytra laeviuscula is a guest in nest of Lasius alienus s.s.

In Great Britain and/or Ireland:
Animal / guest
worker of Myrmecina graminicola is a guest in nest of Lasius alienus s.s.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Animal / sequestrates
queen (newly mated) of Lasius mixtus takes over nest of Lasius alienus s.l.

Animal / sequestrates
queen (newly mated) of Lasius umbratus takes over nest of Lasius alienus s.l.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Lasius alienus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 82
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Lasius alienus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATAATCATTCGACTAGAATTAGGCTCTTCTAATTCATTAATTAATAAT---GATCAAATTTATAATTCTATAGTTACAAGACATGCATTCGTTATAATTTTCTTTATAGTTATACCTTTTATAATTGGAGGATTTGGAAATTTTCTTGTACCTTTAATA---TTAGGCTCACCTGATATAGCATACCCCCGTATAAATAATATAAGATTTTGACTTTTACCTCCCTCAATTTCTCTCCTTCTTTTAAGAAATTTTATTAATGACGGAGTCGGAACAGGATGAACTGTTTATCCTCCATTAGCTTCTAATATTTTTCATAATGGCCCTTCAGTTGACTTA---ACTATTTTTTCTCTTCATATTGCTGGTATATCTTCTATTCTAGGAGCTATCAATTTTATTTCAACTATTATAAATATACATCATAAAAATTTTTCCATTGATAAAATTCCCTTACTTGTATGATCAATTTTAATCACTGCAATTTTATTACTATTATCCCTCCCAGTTCTAGCAGGT---GCAATTACTATACTTTTAACTGACCGTAACCTTAATACTTCATTTTTTGACCCATCTGGCGGCGGAGATCCTATTTTATATCAACATCTCTTCTGATTTTTTGGACATCCTGAAGTTTATATTTTAATTCTCCCTGGATTTGGGCTAATTTCTCATATTATTATAAATGAAAGAGGAAAAAAA---GAAACATTTGGATCTTTAGGAATAATTTATGCTTTAATAGCAATTGGATTTTTAGGATTTGTTGTATGAGCTCACCATATATTTACTATTGGTTTAGATGTTGATACTCGAGCATATTTCACCTCTGCAACTATAATTATTGCTATTCCAACTGGAATCAAAATTTTTAGATGAATTACT---ACTCTTCATGGTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

Considered a house pest and agricultural pest in some parts of the USA.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Antkey

Source: Antkey

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Lasius alienus

Lasius alienus, is a species of ant in the subfamily Formicinae (family Formicidae). Workers have a length of about 2–4 mm, females are larger (7–9 mm).

Distribution[edit]

They live in Europe, from Spain to the Caucasus.

Genetics[edit]

Genome type Lasius alienus: 0,31 m (C value)[1][2]

References[edit]

  1. ^ Database about the size of the genomes of animals.
  2. ^ Tsutsui, ND, AV Suarez, J.C. Spagna, and J.S. Johnston (2008). The evolution of genome size in ants. BMC Evolutionary Biology 8: 64.
  • Seifert, B. (1992). A taxonomic revision of the Palaearctic members of the ant subgenus Lasius s. str. (Hymenoptera: Formicidae). Abhand. Be. Naturkundemus. Goerlitz 66 (5): 1-66.
  • Wilson, E. O. (1955). A monographic revision of the ant genus Lasius, Ph.D. dissert., Harvard University, 105 p.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Subgenus: Lasius.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!