Overview

Comprehensive Description

Biology/Natural History: Feed primarily on kelp (especially Nereocystis or Macrocystis) but can eat sessile invertebrates. Often forms large subtidal aggregations in or near kelp beds. A prime food for sea otters. Other predators include the sunflower star Pycnopodia helianthoides, leather star Dermasterias imbricata, red rock crab Cancer productus, spiny lobster Panulirus interruptus and sheephead fish (in S California), and humans. Commensals include the rhabdocoele flatworm Syndesmis (or Syndisyrinx) franciscanus, less than 1 cm long and lives inside the test, the isopod Colidotea restrata, which clings to the spines, and the amphipod Dulichia rhabdoplastis which builds rods of its fecal pellets that extend out from the urchin's spines (photo). The amphipod feeds on diatoms, which it seems to "farm" on the spines. Plots from which urchins were excluded became overgrown by large algae. Small urchins (less than 5 cm test diameter) often hide under the adults. In Puget Sound they spawn spring and summer. Pelagic echinopluteus larvae metamorphose into benthic juveniles after about 6-10 weeks. Young urchins often are found under larger individuals. Nishizaki and Ackerman (see ref below) found that adult urchins release a chemical cue that causes the young to aggregate underneath them when the adults detect the presence of Pycnopodia helianthoides. Ebert (1998) and Ebert and Southon (2003) determined that these urchins live over 100 years, and found some near Vancouver Island that may be 200 years old. They seem to reproduce best when in dense aggregations (Ebert 1998). Aggregations from which smaller individuals have been harvested recover much faster than those from which larger individuals have been removed (Rogers-Bennet et al., 1998).

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

This is the largest urchin found in the Pacific Northwest. Color of spines varies--may be red, brick red, pink, purple, or even maroon. Spines up to 7 cm long. Up to 20 cm diameter (or more). Test diameter up to 17 cm. Tube feet are dark, often wine red.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

"When young, they are a light fawn brown, but with age the colour of the spines darkens to a deep reddish-purple, pale violet or pale rose." (Lambert, Austin 2007)

Public Domain

Browne, Joy

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographical Range: Gulf of Alaska to Isla Cedros, Baja California; northern Japan

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

"From Kodiak Island, Alaska, to Cedros Island, Baja California" (Lambert, Austin 2007)

Public Domain

Browne, Joy

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Look Alikes

How to Distinguish from Similar Species: Strongylocentrotus purpuratus is smaller and a strong purple color. Small S. franciscanus can look very much like S. purpuratus but S. franciscanus has longer spines--nearly as long as the test is wide. This species is common both on the open coast and protected waters, while S. purpuratus is found mostly on the open coast.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 148 specimens in 1 taxon.
Water temperature and chemistry ranges based on 127 samples.

Environmental ranges
  Depth range (m): -1 - 189.5
  Temperature range (°C): 9.215 - 10.345
  Nitrate (umol/L): 5.774 - 7.622
  Salinity (PPS): 31.235 - 32.111
  Oxygen (ml/l): 6.534 - 6.794
  Phosphate (umol/l): 0.883 - 1.021
  Silicate (umol/l): 12.975 - 20.289

Graphical representation

Depth range (m): -1 - 189.5

Temperature range (°C): 9.215 - 10.345

Nitrate (umol/L): 5.774 - 7.622

Salinity (PPS): 31.235 - 32.111

Oxygen (ml/l): 6.534 - 6.794

Phosphate (umol/l): 0.883 - 1.021

Silicate (umol/l): 12.975 - 20.289
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth Range: Low intertidal to 125 m; mostly subtidal.

Habitat: Rocky reefs, especially around kelp.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

"Gaint Red Sea Urchins feed mainly on drift macroalgae within kelp beds, but when these are not available they eat red foliose and sttached brown seaweeds. They prefer rocky substrates but are capable of moving across sand to locate rocky areas where kelp grows." (Lambert, Austin 2007)

Public Domain

Browne, Joy

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Strongylocentrotus franciscanus preys on:
detritus
Macrocystis pyrifera
Pterygophora californica

Based on studies in:
USA: California, Southern California (Marine)

This list may not be complete but is based on published studies.
  • R. J. Rosenthal, W. D. Clarke, P. K. Dayton, Ecology and natural history of a stand of giant kelp, Macrocystis pyrifera, off Del Mar, California. Fish. Bull. (Dublin) 72(3):670-684, from p. 683 (1974).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Strongylocentrotus franciscanus is prey of:
Pimelometopon pulchrum

Based on studies in:
USA: California, Southern California (Marine)

This list may not be complete but is based on published studies.
  • R. J. Rosenthal, W. D. Clarke, P. K. Dayton, Ecology and natural history of a stand of giant kelp, Macrocystis pyrifera, off Del Mar, California. Fish. Bull. (Dublin) 72(3):670-684, from p. 683 (1974).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 200 years (wild) Observations: The red sea urchin shows no noticeable signs of ageing. It is considered a species with negligible senescence. Estimates suggest these animals might live up to 200 years in the wild (Ebert and Southon 2003). They attain sexual maturity in about 1-2 years (Edwin Iversen and Kay Hale 1992).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

"Based on tagging with dyes, some specimens may live more than 100 years." (Lambert, Austin 2007)

Public Domain

Browne, Joy

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

"Sexes are seperate; females have yellow gonads and males are yellow-orange when in prime condition. During starvation both gonads become dark brown. There is no evidence of alternating sexes. In southern British Columbia, the gonads of this urchin ripen between March and September, and spawning usually peaks in May and ends by late June. In september the gonad begins to recover rapidly and reaches 80 per cent of maximum levels by October. During this time, the urchins feed primarily on drift algae released by storms, which they store as glycogen in the gonad. Between October and April the gametes develop in preparation for the next spawning peak. This is the period when people harvest the urchins for their roe. When spawned, eggs are 130-140 micrometers in diameter. Metamorphosis from echinopluteus larva to juvenile occurs 40 to 152 days after fertilization, depending on water temperature." (Lambert, Austin 2007)

Public Domain

Browne, Joy

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Strongylocentrotus franciscanus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACACTTTATTTGATTTTTGGAGCCTGAGCTGGCATGGTAGGGACAGCTATGAGTGTAATTATCCGTGCCGAATTGGCACAACCCGGTTCTCTACTAAAAGATGACCAAATCTACAAAGTAGTCGTTACCGCACACGCACTGGTCATGATTTTCTTCATGGTGATGCCAATAATGATTGGAGGGTTTGGGAATTGACTCATTCCGCTAATGATTGGTGCACCAGACATGGCTTTCCCCCGTATGAAAAATATGAGATTTTGACTTATTCCCCCTTCCTTTATCTTACTTCTCGCTTCTGCAGGAGTAGAAAGAGGGGCAGGAACTGGATGAACTATTTATCCCCCCCTCTCTAGTAAAATAGCACACGCCGGAGGATCCGTTGACTTAGCGATCTTTTCCCTTCACCTTGCCGGTGCCTCCTCTATTCTAGCCTCAATTAAATTTATAACAACAATAATTAATATGCGAACACCAGGGATGTCTTTTGATCGTCTTCCCTTATTTGTCTGATCTGTCTTCGTTACCGCATTCTTACTACTCCTCTCTCTTCCAGTGCTAGCTGGAGCAATCACCATGCTTCTGACAGATCGAAATATAAATACAACTTTCTTTGACCCAGCAGGAGGAGGAGATCCAATCCTATTCCAACACCTATTCTGATTCTTTGGTCACCCAGAAGTGTATATTCTTATCTTACCAGGATTTGGTATGATTTCACACGTTATAGCTCACTACTCTGGGAAGCGAGAACCCTTTGGATACCTGGGAATGGTTTACGCCATGATTGCAATCGGAGTTTTAGGTTTCCTAGTCTGGGCCCATCATATGTTCACAGTAGGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Strongylocentrotus franciscanus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 46
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 6 specimens with morphological vouchers housed at Florida Museum of Natural History and Museum of Tropical Queensland and Queensland Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Red sea urchin

Strongylocentrotus franciscanus, commonly called the red sea urchin (although its color ranges from pink or orange to nearly black), is a sea urchin found in the Pacific Ocean from Alaska to Baja California. It lives in shallow waters from the low-tide line to 90 metres (300 ft) deep, and is typically found on rocky shores that are sheltered from extreme wave action.[citation needed]

Contents

Physical description

Strongylocentrotus franciscanus juvenile, found at Cape Flattery, WA. This individual is about 1.5 cm in diameter.

A sea urchin's spherical body is completely covered by sharp spines that can grow up to 8 cm (3.1 in). These spines grow on a hard shell called the "test", which encloses the animal. The oldest ones have been measured to be around 19 cm (7.5 in) in diameter. It can vary in color from red to dark burgundy. Rarely, albino specimens are found. A sea urchin has no visible eyes or legs. It has a mouth located on its underside, which is surrounded by five teeth. During larval development, the body of a sea urchin transitions from radial to bilateral symmetry.

This bilaterally symmetrical larva, called an echinopluteus, subsequently develops a type of pentaradiate symmetry that characterises echinoderms. It crawls very slowly over the sea bottom using its spines as stilts, with the help of its tube feet. Scattered among its spines are rows of tiny tube feet with suckers that help it to move and stick to the sea floor.

Feeding habits

The animals have a mouth with special jaws (Aristotle's lantern) located on the bottom (oral) surface. Their preferred diet is seaweeds, kelp and algae, which they scrape off and tear up from the sea floor. During larval development, urchins use bands of cilia to capture food from the water column.[1] Red sea urchins found in the channel adjacent to San Juan Island have been found to live a uniquely sedentary lifestyle with the heavy currents bringing an abundance of food.[2]

Behavior and reproduction

Sea urchins are often found living in clumps from five to ten. They have the ability to regenerate lost spines. Lifespan often exceeds 30 years, and scientists have found some specimens to be over 200 years old.[3]

Spawning peaks between June and September. Eggs are fertilized externally while they float in the ocean, and planktonic larvae (echinopluteus) remain in the water column for about a month before settling on the bottom of the sea floor, where they undergo metamorphosis into juvenile urchins. These juveniles use chemical cues to locate adults. Although juveniles are found almost exclusively under aggregated adults, the adults and juveniles are not directly related. Red Sea Urchins can effectively reproduce at an advanced age.[citation needed]

References

  1. ^ Richard R. Strathmann (1971). "The feeding behavior of planktotrophic echinoderm larvae: mechanisms, regulation, and rates of suspension feeding". Journal of Experimental Marine Biology and Ecology 6 (2): 109–160. doi:10.1016/0022-0981(71)90054-2. 
  2. ^ Whippo, R; Lowe, A; Britton-Simmons, K (2011). "Effects of the Red Sea Urchin on Benthic Invertebrate Communities: A Link to Spatial Subsidies". In: Pollock NW, ed. Diving for Science 2011. Proceedings of the American Academy of Underwater Sciences 30th Symposium. Dauphin Island, AL: AAUS; 2011. Retrieved 2013-03-18. 
  3. ^ Thomas A. Ebert & John R. Southon (2003). "Red sea urchins (Strongylocentrotus franciscanus) can live over 100 years: confirmation with A-bomb 14carbon" (PDF). Fishery Bulletin 101 (4): 915–922. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!