Overview

Comprehensive Description

Description

 Strongylocentrotus droebachiensis grows up to 8cm in diameter with a low flat profile. Skeletal plates are greenish-brown with numerous reddish, greenish, or even violet spines that are usually white tipped.May retreat further north with rising water temperatures. Can occur in plagues or swarms which devastate kelp beds in Norway.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology/Natural History: S. droebachiensis feed on large algae such as bull kelp, green algae, and laminarians, they also scrape diatoms and coralline algae off rocks. They are harvested commercially for their roe, which is a delicacy in Japan. In the Gulf of Maine, males at widely separated populations seem to be release sperm at similar times, suggesting that they are responding to a widespread environmental signal. Spawning was most intense during full and new moon (spring tides). However, extensive sperm release seems to occur mainly in large urchin swarms, suggesting that the presence of spawning of nearby urchins triggers spawning by others (Gaudette et al., 2006). In the Barents Sea, Russia, spawning peaks late February to April, in temperatures ranging from 0.4 to 1.8 C (Oganesyan, 1998).

Microsatellite analysis (Addison and Hart, 2004) shows strong population differentiation between Pacific and Atlantic populations. This shows there is little gene flow between the Atlantic and Pacific populations.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This particular species is widely distributed in northern waters. Usually this urchin is greenish with reddish brown tones scattered here and there. Tube feet are generally darker than the spines and usually purple. These urchins are radially symmetrical and its diameter is not more than twice its thickness. It has spines that are crowded, short and rather fine. The test may be 8.3 cm wide with the spines reaching around 2.5 cm. Key characteristics for these urchins are jaws that lack lateral teeth, an anus situated outside the apical system, radial symmetry, and more than three pore plates per ambulacral plate. The ridges on the spines have rounded surfaces and periodic sculpturings (these somewhat fan-shaped)
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

A medium-sized regular sea urchin found only in the northern part of the British Isles. Colour is greenish-brown with large conspicuous pedicellariae obvious amongst the spines. The spines are greenish with white tips. The tube-feet are in arcs of 5-6. Up to 8cm. in diameter. The distribution does not overlap with Paracentrotus lividus and this is a more robust urchin than Psammechinus miliaris.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

From low intertidal, down to more than 200 m depth, on rocky and stony shores and offshore rough grounds, Scotland, Sshetland, northeast coast of England and northern North Sea
  • Southward, E.C.; Campbell, A.C. (2006). [Echinoderms: keys and notes for the identification of British species]. Synopses of the British fauna (new series), 56. Field Studies Council: Shrewsbury, UK. ISBN 1-85153-269-2. 272 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Circumpolar
  • Hayward, P.J.; Ryland, J.S. (Ed.) (1990). The marine fauna of the British Isles and North-West Europe: 1. Introduction and protozoans to arthropods. Clarendon Press: Oxford, UK. ISBN 0-19-857356-1. 627 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Arctic to New Jersey; Alaska to Puget Sound
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Strongylocentrotus droebachiensis inhabits colder temperatures of mostly northern oceans. Green sea urchins are found in coastal areas of Alaska to Washington, the western part of the Baltic Sea, on the coast of Korea, as well as in almost every other type of major marine habitats.

Biogeographic Regions: arctic ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Confined to the north of the British Isles, common in Shetland and recorded from NE coasts of Scotland and the North Sea.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Strongylocentrotus droebachiensis acquire their common name, "green sea urchin" from the green outer shell. All sea urchins have an exoskeleton made of calcitic plates rooted into their skin. The solid exoskeleton, or the test, is composed of several plates that are tightly bound together. The mouth is located in the center of the peristomial membrane. This membrane is composed of a flexible collogenous skin that is tough and serves as a type of lip-like structure. Teeth are found in the mouth to help tear off food to eat. Another structure that is commonly found with almost all sea urchins is the pedicellaria, tiny stalked valves used to keep the surface of the sea urchin clean by removing small particles it encounters. Sea urchins have spines and tubes that serve roles in acquiring food, protection and respiration. The tube-feet on the sea urchins are a type of suction discs that allow them to adhere onto other organisms or substances. They have also have an internal skeleton called the stereom.

Green sea urchins are very small, compact animals that usually do not exceed a length of 8 cm. The average size for a green sea urchin is about 7.8 cm. The larval forms are bilaterally symmetric. After metamorphosis they measure about 0.5 mm and are radially symmetric. The sexes are monomorphic.

Range length: 0.5 to 80 mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry ; radial symmetry

Sexual Dimorphism: sexes alike

  • Thurman, H., H. Webber. 1984. Marine Biology. Columbus, Ohio: Charles E. Merrill Publishing Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

How to Distinguish from Similar Species: Since juvenile S. purpuratus urchins may have pale green spines, S. droebachiensis may be mistaken for them. S. pallidus, a deep subtidal species, is a lighter green and its tube feet are as light or lighter than its spines.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

midlittoral, bathyal, infralittoral and circalittoral of the Gulf and estuary
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Green sea urchins live primarily in areas with cold waters mainly in the northern hemisphere. Green sea urchins prefer living in rocky, or gravel areas, but they are mostly found in sandy, sea floor bottoms. Adults live in cold climates in water temperatures from 0 to 15 degrees Celsius. Green sea urchins are found between intertidal zones to about 1200 meters. The rate at which urchins take in or remove oxygen does not depend on water temperature.

The green sea urchin is one of the only urchins that has expanded into an environment of brackish water such as the Baltic Sea.

Average depth: 1200 m.

Habitat Regions: saltwater or marine

Aquatic Biomes: benthic ; coastal

Other Habitat Features: intertidal or littoral

  • Banister, D., D. Campbell. 1985. The Encyclopedia of Aquatic Life. New York, N.Y.: Facts on File.
  • Grzimek, B. 1972. Grzimek's Animal Life Encyclopedia: Volume 3- Mollusks and Echinoderms. New York: Van Nostand Reinhold Company.
  • Roessler, C. 1977. Underwater Wilderness. New York: Chanticleer Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2586 specimens in 2 taxa.
Water temperature and chemistry ranges based on 1912 samples.

Environmental ranges
  Depth range (m): -3 - 2170
  Temperature range (°C): -1.377 - 18.189
  Nitrate (umol/L): 1.417 - 44.345
  Salinity (PPS): 31.008 - 35.574
  Oxygen (ml/l): 1.175 - 8.585
  Phosphate (umol/l): 0.262 - 3.038
  Silicate (umol/l): 1.488 - 117.986

Graphical representation

Depth range (m): -3 - 2170

Temperature range (°C): -1.377 - 18.189

Nitrate (umol/L): 1.417 - 44.345

Salinity (PPS): 31.008 - 35.574

Oxygen (ml/l): 1.175 - 8.585

Phosphate (umol/l): 0.262 - 3.038

Silicate (umol/l): 1.488 - 117.986
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 Strongylocentrotus droebachiensis is found on the lower shore and infralittoral fringe down to 1200 m on rocky grounds browsing on algae. In the few locations, where it is found in Britain, it occurs in the lower infralittoral and upper circalittoral.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

A typical shore form, also common in shallow water at sheltered sites often in fairly strong currents.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Green sea urchins feed on a wide variety of organisms, ranging from marine worms to sponges. However, this specific urchin particularly feed on a type of kelp known as Laminaria. Green sea urchins also eat bull kelp and green algae. Often, green sea urchins scrape the surface of rocks using their "Aristotle's lantern," or masticatory apparatus, in search of diatoms as well as algae. Whenever an urchin is injured, the other urchins immediately move away, but they return within a short time span to eat it.

Plant Foods: algae; macroalgae

Primary Diet: omnivore

  • Friedrich, H. 1969. Marine Biology. United States: University of Washington Press.
  • Valiela, I. 1995. Marine Ecological Processes. New York: Springer-Verlag New York, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Breeding

Echinopluteus larva. January to May
  • Southward, E.C.; Campbell, A.C. (2006). [Echinoderms: keys and notes for the identification of British species]. Synopses of the British fauna (new series), 56. Field Studies Council: Shrewsbury, UK. ISBN 1-85153-269-2. 272 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diet

Basically herbivorous but also ingests encrusting invertebrates including young Mytilus.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Sexes of S. droebachiensis are separate, but monomorphic (similar in appearance). Green sea urchins, take several years to reach a point where they are sexually mature and capable of reproducing. For reproduction to occur there must be a large number of individuals. Reproduction occurs when both sperm and eggs are released simultaneously into the water column by both male and female urchins. There are about 100,000 to about 200,000 eggs released by female urchins. When these eggs are fertilized, they quickly form swimming larva known as echinopluteus, which feed off plankton. Then, slowly they mature into adult sea urchins. Urchins are about 0.5 mm after metamorphosis.

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate); fertilization (External ); oviparous

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Strongylocentrotus droebachiensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 16 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGCAACTAAGACGATGATTATTTTCTACTAACCACAAGGACATCGGAACACTTTATTTGATTTTGGTAGCCTGAGCTGGCATGGTAGGTACAGCTATGAGTGTGATTATCCGTGCCGAATTGGCACAGCCTGGTTCTCTACTAAAAGATGATCAGATATACAAAGTAGTCGTCACCGCACATGCGCTAGTAATGATTTTCTTCATGGTAATGCCAATAATGATTGGTGGATTTGGGAATTGACTCATTCCACTGATGATCGGTGCACCAGACATGGCCTTTCCCCGTATGAAAAATATGAGCTTTTGACTTATTCCCCCTTCCTTTATATTACTTTTAGCCTCTGCAGGAGTAGAGAGGGGAGCAGGGACTGGCTGAACTATTTACCCCCCTCTCTCTAGTAAAATAGCACACGCCGGAGGATCCGTTGATTTAGCGATCTTCTCCCTCCACCTTGCCGGTGCCTCTTCTATCTTAGCCTCAATTAAATTTATAACAACAATTATTAATATGCGGACACCAGGAATGTCTTTTGATCGTCTTCCTTTATTTGTCTGATCCGTCTTTGTTACCGCATTCTTACTACTCCTTTCCCTCCCAGTCTTAGCTGGAGCAATTACAATGCTTCTTACAGACCGTAAAATAAACACAACTTTCTTCGATCCAGCAGGGGGAGGTGACCCAATTCTATTCCAACACTTATTCTGATTTTTTGGTCACCCAGAAGTATACATTCTTATCTTGCCGGGATTTGGCATGATCTCACACGTCATAGCTCACTACTCTGGAAAGCGGGAGCCTTTCGGGTACCTGGGAATGGTTTATGCCATGATTGCAATAGGGGTTTTAGGATTCCTTGTCTGAGCCCACCATATGTTTACAGTAGGAATGGATGTTGATACACGAGCATACTTCACTGCCGCCACGATGATCATTGCTGTTCCAACAGGAATTAAGGTTTTCAGATGAATGGCAACGCTCCAAGGATCTAATCTACAATGGGAAACTCCCCTACTGTGAGCCTTGGGATTTGTATTTTTATTCACCCTAGGAGGACTCACAGGTATTGTTCTCGCCAATTCCTCCATTGACGTTGTTCTTCATGATACCTACTACGTAGTAGCTCACTTTCACTACGTTCTTTCGATGGGGGCCGTATTTGCAATCTTTGCTGGGTTCACTCACTGATTTCCCCTCTTCTCTGGATATAGCCTACACCCGTTATGAGGAAAGGTTCACTTCTTCATAATGTTTGTTGGGGTCAACTTAACCTTTTTTCCTCAACACTTCTTAGGTCTAGCCGGGATGCCACGGCGGTACTCAGACTACCCAGACGCTTACACACTTTGAAATACTATCTCCTCAATTGGATCAACCATCTCCGTGGTCGCTATGTTGTTTTTCCTTTTTTTAATCTGAGAGGCCTTCGCTTCTCAGCGGGAGGGGATCACCCCAGAGTTCTCACACGCCTCACTCGAGTGACAGTACACCTCCTTTCCACCTTCTCACCACACCTTCGATGAAACACCCTCTACCATAATTATTGTGAAGTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Strongylocentrotus droebachiensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 27
Specimens with Barcodes: 33
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Australia Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

At this point, the green sea urchins and its habitat are not in any way threatened by the environment.

However, if green sea urchins were to be reduced in population, there would be mass amounts of kelp that would cause the water to be congested. This congestion does not allow boats to pass through the water. Therefore, it is important to preserve populations of this species.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of green sea urchins on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

This species is harvested for its roe, which is considered a delicacy in Japan.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The green sea urchin species, Strongylocentrotus droebachiensis, plays an important role in many fishing economies. In 1999, the green sea urchin fishery was the fourth largest fishery by value in Maine, worth $20.3 million (Chen et al. 2003). Sea urchins, including Strongylocentrotus droebachiensis, provide humans with a source of food, and the fishing industry of these species creates new job opportunities in the coastal areas.

Public Domain

Anoka Ramsey Community College

Source: Anoka Ramsey Community College

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Strongylocentrotus droebachiensis are herbivores and are an important agent to kelp deforestation (Steneck et al. 2002). They are typically found in the Northwestern and Northeastern Atlantic where Strongylocentrotus droebachiensis often over-graze the kelp forests and marine vegetation (Norderhaug & Christie 2009). When populations are under control, Strongylocentrotus droebachiensis are beneficial to marine ecosystems because grazing maintains the kelp forest and prevents unchecked kelp population overgrowth. A well-balanced equilibrium is essential for the interaction between sea urchins, humans, and kelp forests. Strongylocentrotus droebachiensis and other sea urchins graze on the kelp to prevent kelp from becoming overabundant, and humans fish for sea urchins for food and to prevent over-grazing of the kelp forests.

Public Domain

Anoka Ramsey Community College

Source: Anoka Ramsey Community College

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Strongylocentrotus droebachiensis

Strongylocentrotus droebachiensis is commonly known as the green sea urchin because of its characteristic green color. It is commonly found in northern waters all around the world including both the Pacific and Atlantic Oceans to a northerly latitude of 81 degrees and as far south as the Puget Sound (Washington State) and England. The average adult size is around 50 mm (2 in), but it has been recorded at a diameter of 87 mm (3.4 in). The green sea urchin prefers to eat seaweeds but will eat other organisms that float by or even catch small fish. They are eaten by a variety of predators, including sea stars, crabs, large fish, mammals, birds, and humans.

Habitat[edit]

Strongylocentrotus droebachiensis is found on rocky substratum in the intertidal and up to depths of 1,150 meters (3,770 ft). It uses its strong Aristotle's lantern to burrow into rock, and then can widen its home with the spines. Usually, this sea urchin can leave its hole to find food and then return, but sometimes it creates a hole that gets bigger as it gets deeper, so that the opening is too small for S. droebachiensis to get out. S. droebachiensis is a euryhaline species, and can survive in waters of low salinity. This allows it to flourish in the south Puget Sound. Acclimation and size are important factors as larger individuals have a lower surface area to volume ratio and can handle the increased osmotic tension.[1]

Anatomy[edit]

Underside of S. droebacheinsis
S. droebachiensis righting itself

External anatomy[edit]

Strongylocentrotus droebachiensis is in the shape of a slightly flattened globe (dorsoventrally). The oral side rests against the substratum and the aboral side (the side with the anus) is in the opposite direction. It has pentameric symmetry, which is visible in the five paired rows of podia (tube feet) that run from the anus to the mouth. The size is calculated as the diameter of the test (the body not including the spines). This is a relatively fast growing sea urchin, and its age is generally calculable based on its size: one year for every 10 mm.[2]

Spines[edit]

The spines of Strongylocentrotus droebachiensis are used for defense and locomotion and are not considered poisonous. The spines attach to small tubercles on the test where they are held in place by muscles creating a ball and socket joint. They are round, tapering to a point, with ridges around the outside in a fan-like design made of calcium carbonate. Usually, the longest spines are around the peripheral edge of the animal. If broken, the spines will regenerate, and if completely torn off, the tubercle will be reabsorbed to fit the slowly growing spine.

Tube feet[edit]

Tube feet are a structure that help Strongylocentrotus droebachiensis attach to the substratum for stabilization or locomotion, or to move loose food particles to the mouth. The tube feet are quite flexible and can extend beyond the length of the spikes to reach the substratum or attach onto particles floating in the water. They come out of five pairs of rows through the test structure.

The tube feet of S. droebachiensis are actually composed of two parts: the ampulla and the podium. The ampulla is a hollow bulbous structure that raises the tube foot above the skeletal plates that surround the lateral canal. The podia extend off the ampulla and contain the muscular suckered structure used for attachment. The movement of the tube foot depends on the hydraulic pressure of the water vascular system, and individual muscle action. When the ampulla contracts, it forces the liquid into the podia which elongates. Once the podia has attached itself to the substrate, the longitudinal muscles of the podia constrict forcing that liquid back into the ampulla causing the podia to shrink and pulling the body in that direction, or food closer to the mouth. Tube feet that have been pulled off as the sea urchin is thrown around by the sea will quickly regenerate.

Pedicellariae[edit]

Echinoderms of the classes Asteroidea (sea stars) and Echinoidea (sea urchins/sand dollars) have three small pincher-like jaws held up by a calcerous stalk, called pedicellariae, at the base of the spines on the body. These have the ability to respond to outside stimuli separately from the main nervous system. Historically thought of as parasites or larvae of the sea urchin, it is now commonly believed that the pedicellariae are actually part of the living creature. The muscles that control them are outside of the test, and therefore must get nutrients from a different source: they have possibly developed the ability to absorb nutrients directly from the surrounding water.

Pedicellariae are used by the sea urchin by keeping detritus from collecting on the body, or collecting kelp to use as a defense from the drying abilities of the sunlight. Their pinching jaws can even be used to defend against possible predators, and some are even poisonous on S. droebachiensis. If the spikes are lightly touched, they converge toward the pressure, but if they are strongly pushed, then they spread apart so that the pedicellariae can pinch the intruder. One of the four main types of pedicellariae on S. droebachiensis is actually poisonous and can be used for defense, or to paralyze small fish (although this species prefers algae, it will catch and eat fish for supplemental food).

Test[edit]

Twenty curved plates, or ossicles, are fused together to form a rigid test or exoskeleton. They are made of calcium carbonate, and have two rows of holes for the tube feet to pass through. If the test is cracked or chunks are removed, calcium carbonate will slowly fill in the gaps left behind until a complete and rigid test is regained.

Internal anatomy[edit]

Water vascular system[edit]

The water vascular system is a series of canals through which fluid moves to help propel the podia of the sea urchin. The fluid that fills the water vascular system is similar to marine water, but also has free wandering cells and organic compounds such as proteins and a high concentration of potassium ions when compared to the surrounding sea water. This liquid is moved through the system by cilia that line the inside of the canal and help keep the fluid moving in the desired direction.

The structure of the water vascular system contains several calcareous parts before moving to the podia. The first is called the madreporite. This is a skeletal plate, or sieve, opening to the water vascular system, located on the aboral surface. Just underneath the madreporite, is a cup-like depression called the ampulla. Next the stone canal carries the liquid into the central disc of the urchin. Finally, five lateral canals run along the inside of the test and converge at the aboral pole. Along this entire distance, tube feet emerge from the lateral canal through the test to outside the epidermis of the sea urchin.

Aristotle's Lantern[edit]

Strongylocentrotus droebachiensis eats by using a special appendage called Aristotle’s Lantern to scrape or tear their food into digestible bits. This structure is made of five, calcareous, protractible teeth that are maneuvered by a complex muscular structure. The sea urchin crawls on top of its food and uses Aristotle's Lantern to tear up and masticate chunks of it. If food lands on the aboral surface or is caught by pedicellariae, then it is carried via podia to the mouth and devoured in the same manner.

Digestive system[edit]

The digestive system begins with Aristotle’s Lantern where the food enters the body of the sea urchin. An esophagus extends from the mouth through the center of Aristotle’s Lantern, where it joins up with an intestine. The intestine is arranged in little bundles that adhere to the inside of the test in a counter-clockwise circuit around Aristotle’s Lantern. Once the intestine gets back to itself, it doubles over itself and reverses directions in a second clockwise direction. Digestive enzymes are produced by the intestinal walls and breakdown of food is almost completely extracellular. From the intestine, what is left of the food moves out of the intestine into the short rectum, and out the anus. S. droebachiensis gets its green color from the pigments of its plant food.

Nervous system[edit]

In the nervous system of sea urchins the spines, podia, and pedicellariae all act as sensors. A circular nerve ring encircles the esophagus, and radial nerves extend inside of the test parallel to the lateral canals of the water vascular system. Sensory neurons in the epidermis can detect touch, chemicals, and light, and are usually associated with pedicellariae or spines.

Reproduction and development[edit]

Sea urchins are dioecious, meaning they either contain male or female reproductive organs. They contain five gonads tucked under the test. These are located close to the anus and are protected by genital plates. One of these plates is perforated, and also acts as the madreporite. Sea urchins all release their eggs or sperm directly into the water column at the same time to ensure fertilization. It is not understood what causes S. droebachiensis to release their sperm or eggs, but it may have to do with temperature, because they usually reproduce in early spring.

Once fertilized, the gamete grows via mitosis and eventually becomes a larva capable of simple swimming called an echinoplutes. The metamorphosis from larva to a radially symmetrical adult is hugely complex, and only some of the more basic details are included here. The larva swims to the appropriate substratum where it attaches, usually with the “left and right” sides of the larva, becoming the “mouth and anus” sides.[3] The embryonic openings for the mouth and the anus disappear completely, and new openings are created in the proper position. The ring canal grows radial extensions becoming the lateral canals. At this point in development, the sea urchin settles down to a benthic life.

Symbiosis[edit]

Snails of the families Melanellidae and Stiliferidae live on the surface of the test and adhere their own eggs to the base of the spines as protection.

As food[edit]

The green urchin is edible, and is known to have been eaten by the Native peoples of New Brunswick from archaeological remains.[4]

Footnotes[edit]

  1. ^ Campbell, J., and M.P. Russel. 2003. Acclimation and growth response of the green sea urchin Strongylocentrotus droebachiensis to flucuating salinity. Proceedings of the InternationalConference on Sea Urchin Fisheries and Acuaculture, pp. 110-117. DEStech Publications, Inc.
  2. ^ Hyman, Libbie Henrietta. The Invertebrates: Echinodermata The Coelomate Bilateria. 1955 .
  3. ^ Brusca, Richard C. & Brusca, Gary J. Invertebrates. 2003.
  4. ^ http://books.google.com/books?id=6T2JomruARoC&pg=PA1&dq=%22Strongylocentrotus+droebachiensis%22+native&hl=en&sa=X&ei=FY06UZPeKNK90QHwooCwCg&ved=0CD8Q6AEwAw#v=onepage&q=%22Strongylocentrotus%20droebachiensis%22%20native&f=false

References[edit]

Brusca, Richard C., and Brusca, Gary J. Invertebrates. 2nd. Sinauer Associates, Inc. Sunderland, MA 2003. Brusca, Richard C. & Brusca, Gary J. Invertebrates. Sinauer Associates, Inc., Publishers Sunderland. Massachusetts 2003 Hyman, Libbie Henrietta. The Invertebrates: Echinodermata The coelomate Bilateria. Volume IV. McGraw-Hill Book Company. London 1955 Kozloff, Eugene N. Marine Invertebrates of the Pacific Northwest. 2nd. University of Washington Press. Seattle 1996. Kozloff, Eugene N. Seashore Life: of the Northern Pacific Coast. University of Washington Press. Seattle 1993

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!