Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Fossil species

recent & fossil

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Unlike those infamous sea urchins in the Mediterranean Sea, the spines of the green sea urchin are not poisonous. However, should you accidentally step on one, it can inflict tremendous pain. Green sea urchins have an unusual chewing organ, referred to as 'Aristotle's lantern'. It is a small gripping appendage containing protractible teeth. You can compare the mouth of a green sea urchin to one of those games at a fair, where you try to grab something with a mechanical arm. The sea urchin crawls on top of its food and uses its mouth to scrape the bottom, tear off pieces or dredge it up.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Comprehensive Description

Description

 An almost round, slightly flattened urchin that grows up to 57 mm in diameter (although more typically to 35 mm diameter). It is greenish in colour with distinctive violet tips to the spines. The spines are robust, short and closely packed.
  • Sometimes called the purple tipped sea urchin. Older publications may refer to sea urchins as "burrs" (Hancock, 1957). Strongylocentrotus droebachiensis is also known as the green sea urchin. It is possible for Psammechinus miliaris to be confused with Strongylocentrotus droebachiensis or pale specimens of Paracentrotus lividus.
  •  
  • A regular sea urchin with a somewhat flattened test. The colour varies with habitat (Bull, 939; Lindahl & Runnström, 1929; Comely, 1979). Shallow water or littoral individuals are a deep purplish-brown and show no difference between the colour of the test and spines. Those from deeper water tend to be paler in colour, with a light green test and vivid purple spine tips.
  •  
  • The tube-feet are arranged in arcs of 3, visible as 3 pairs of pores corresponding with each ambulacral plate on the denuded test.
  •  
  • A typical species of bouldered sheltered shores, also found sublittorally in shallow water in sheltered or slightly brackish sites such as sea lochs. Common in the circalittoral on exposed shores in Shetland.
 MarLIN would like to thank Dr Maeve Kelly for her comments and significant additions to the review.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

A regular sea urchin with a somewhat flattened test and green overall colour. The tips of the spines are violet. The tube-feet are arranged in arcs of 3, visible as 3 pairs of pores corresponding with each ambulacral plate on the denuded test. Typically 5cm. in diameter. Could be confused with Paracentrotus lividus or Strongylocentrotus droebachiensis.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Intertidal in pools, sometimes with Paracentrotus lividus, also under stones; sublittoral down to about 100 m on rock and gravel. Common all round the British Isles
  • Southward, E.C.; Campbell, A.C. (2006). [Echinoderms: keys and notes for the identification of British species]. Synopses of the British fauna (new series), 56. Field Studies Council: Shrewsbury, UK. ISBN 1-85153-269-2. 272 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not present in the Mediterranenan, where a separate species P. microtuberculatus occurs
  • Hayward, P.J.; Ryland, J.S. (Ed.) (1990). The marine fauna of the British Isles and North-West Europe: 1. Introduction and protozoans to arthropods. Clarendon Press: Oxford, UK. ISBN 0-19-857356-1. 627 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Found all round the British Isles north to Scandinavia and south to Morocco but absent from the Mediterranean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 309 specimens in 1 taxon.
Water temperature and chemistry ranges based on 105 samples.

Environmental ranges
  Depth range (m): 0 - 136
  Temperature range (°C): 6.889 - 12.348
  Nitrate (umol/L): 1.402 - 12.829
  Salinity (PPS): 31.635 - 35.363
  Oxygen (ml/l): 5.952 - 6.746
  Phosphate (umol/l): 0.262 - 0.772
  Silicate (umol/l): 0.987 - 8.436

Graphical representation

Depth range (m): 0 - 136

Temperature range (°C): 6.889 - 12.348

Nitrate (umol/L): 1.402 - 12.829

Salinity (PPS): 31.635 - 35.363

Oxygen (ml/l): 5.952 - 6.746

Phosphate (umol/l): 0.262 - 0.772

Silicate (umol/l): 0.987 - 8.436
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 Found intertidally on rocky shores under stones, boulders and seaweeds especially Saccharina latissima. Also found subtidally in seagrass beds or on mixed coarse bottoms such as muddy sand and gravel.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

A typical species of bouldery sheltered shores, occasionally found sublittorally in shallow water in sheltered or slightly brackish sites such as sea lochs. Common in the circalittoral on exposed shores in Shetland.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dispersal

Depth range

0-100 m
  • Mortensen, T. 1943. A Monograph of the Echinoidea. III, 3. Camarodonta. II. Echinidæ, Strongylocentrotidæ, Parasaleniidæ, Echinometridæ, pp. 446. C. A. Reitzel; Copenhagen.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Animal / parasite / ectoparasite
adult of Pelseneeria stylifera ectoparasitises Psammechinus miliaris

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Breeding

Echinopluteus larva. Spring to autumn
  • Southward, E.C.; Campbell, A.C. (2006). [Echinoderms: keys and notes for the identification of British species]. Synopses of the British fauna (new series), 56. Field Studies Council: Shrewsbury, UK. ISBN 1-85153-269-2. 272 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Psammechinus miliaris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACTGCCATGAGAGTAATTATACGCGCCGAGCTAGCACAACCAGGATCCCTACTAAAAGAT---GACCAGATCTATAAAGTAGTTGTTACCGCACACGCACTAGTTATGATATTTTTTATGGTAATGCCTATAATGATAGGAGGCTTTGGAAACTGACTAATACCTTTGATGATAGGTGCACCAGACATGGCTTTCCCTCGAATGAATAAAATGAGCTTCTGACTGGTACCCCCCTCTTTTATTCTACTGTTGGCTTCAGCAGGTGTAGAAAGAGGAGCCGGGACAGGATGAACTATTTATCCCCCTCTCTCAAGTAAAATAGCCCACGCCGGGGGGTCCGTTGACCTAGCGATTTTTTCTCTACATCTTGCAGGGGCTTCCTCTATTTTAGCCTCAATTAACTTTATTACTACAATTATTAATATGCGAACACCAGGAATGTCATTTGATCGCCTACCTCTATTTGTTTGGTCCGTATTTGTCACAGCGTTCTTGCTATTGTTATCCTTACCAGTATTGGCTGGGGCGATTACTATGCTTTTAACAGACCGAAATATTAATACTACATTCTTTGACCCAGCAGGAGGAGGAGACCCCATTCTATTCCAGCACTTATTCTGGTTTTTTGGCCACCCTGAGGTTTATATTTTAATTCTACCTGGATTCGGCATGATTTCTCACGTAATAGCCCATTACTCTGGGAAGCGAGAACCTTTCGGTTACTTAGGAATGGTTTACGCTATGATAGCAATTGGAGTTCTTGGATTTTTAGTCTGAGCCCACCATATGTTCACCGTAGGT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Psammechinus miliaris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Psammechinus miliaris

Psammechinus miliaris is a species of sea urchin in the family Parechinidae. It is sometimes known as the green sea urchin or shore sea urchin. It is found in shallow areas of the eastern Atlantic Ocean and the North Sea.

Contents

Description

MRI scan

The test is globular, somewhat flattened dorso-ventrally, and up to five centimetres in diameter. It is covered in short, equi-length robust spines. The test and spines of shallow water specimens are purplish-brown but specimens from deeper water have a greenish test and pale coloured spines with purple tips. If individuals are transferred from one depth range to another, they retain their original colouration in their new location.[2] On each ambulacral plate there are three pairs of tubercles each with a spine attached, the central one being a primary spine. On the ventral side, the orifices are relatively small and the buccal membrane is closely packed with thick plates with many pedicellariae but no spines. The globiferous pedicellariae are numerous but small and the tridentate pedicellariae are stout with broad blades.[3]

Distribution and habitat

P. miliaris occurs in the eastern Atlantic Ocean from Scandinavia south to Morocco, but not in the Mediterranean Sea. It is particularly common in the North Sea. It is mostly a littoral species but can be found from low tide mark down to a depth of one hundred metres. It is often found on or under Saccharina latissima, a large brown seaweed with which it shares its range. It occurs in a range of other habitats including under boulders and rocks, among seaweed, on rough ground such as oyster banks, in burrows in gravelly sediments and on the rhizomes of Zostera marina in seagrass meadows. The larvae often settle onto man-made structures such as ropes close to aquaculture facilities.[2]

Biology

P. miliaris is an omnivore and feeds on marine worms, hydroids, small crustaceans, molluscs, diatoms, macroalgae and detritus. It eats both fresh and rotting kelp (S. latissima) but the former is more difficult to digest and takes longer to pass through the gut. It is effective at removing fouling organisms from salmon cages and oyster trays. [2]

Spawning takes place in spring and early summer. The female releases a single batch of 80,000 to 2,500,000 eggs into the water column where they are fertilised. The echinopluteus larvae form part of the zooplankton for one to two months before settling on the sea bed and undergoing metamorphosis.[4]

P. miliaris is sometimes present in large numbers in suitable habitats. In a shallow Zostera marina meadow off the west coast of Scotland, they were recorded at 182 per square metre and 28 per square metre on the adjacent muddy sediment.[5] In littoral habitats they can reach densities of 352 individuals per square metre.[6] Their grazing and predation have a considerable effect on the benthic ecology and if they are experimentally removed from an area, there is a significant change in the community of encrusting organisms. In one study it was found that the tube worm Pomatoceros increased as did the more ephemeral algal species. Another study found that an individual urchin could eat 8 to 12 barnacles (Semibalanus balanoides) or 6 mussels (Mytilus edulis) in a day.[2]

Use as food

The gonads of P. miliaris are sometimes eaten, particularly in Mediterranean cuisine. They are small in specimens caught in the wild but larger in individuals that have been eating prepared salmon food [2] and the possibility of aquaculture is being investigated.[4]

References

  1. ^ a b Psammechinus miliaris (P.L.S. Müller, 1771) World Register of Marine Species. Retrieved 2011-08-25.
  2. ^ a b c d e Ecology of Psammechinus miliaris Google Books. Retrieved 2011-08-25.
  3. ^ Shore Sea Urchin (Psammechinus miliaris) Marine Species Identification Portal. Retrieved 2011-08-26.
  4. ^ a b Green sea urchin - Psammechinus miliaris Marine Life Information Network. Retrieved 2011-08-26.
  5. ^ Comely, C.A., (1979). Observation on two Scottish West coast populations of Psammechinus miliaris. Scottish Marine Biological Association, Internal Report, Oban.
  6. ^ Kelly, M.S., (2000). The reproductive cycle of the sea urchin Psammechinus miliaris (Echinodermata: Echinoidea) in a Scottish sea loch. Journal of the Marine Biological Association of the United Kingdom, 80, 909-919.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!