Overview

Brief Summary

Fossil species

Fossil range: recent & fossil
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

 This sea urchin has a round, flattened test up to 7 cm in diameter. It has long, sharply pointed spines which are dark purple to dark green and has a greenish test.The gonads are considered a delicacy in the Mediterranean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

A dark purple, almost black, regular sea urchin found on western coasts of Ireland and occasionally elsewhere. The roes of this urchin are edible and are prized as a delicacy in Mediterranean countries. The tube-feet are arranged in arcs of 5-6, visible as 5-6 pore pairs corresponding with each ambulacral plate. Up to 7cm. in diameter. Pale specimens are sometimes confused with Psammechinus miliaris.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Adriatic Sea, Aegean Sea, Arcachon Bay, Azores, Azores Exclusive Economic Zone, Canaries, Central Mediterranean, Channel Islands, Cornwall, Devon, English Channel, European waters (ERMS scope), French Exclusive Economic Zone [Atlantic part], French Exclusive Economic Zone [Mediterranean part], Greek Exclusive Economic Zone, Irish Exclusive economic Zone, Island of Skye, Levantine Basin, Mediterranean Sea, Moroccan Exclusive Economic Zone, Morocco, Scilly Isles, South Coast of England, South Coast of Ireland, South Ireland, United Kingdom Exclusive Economic Zone, West Coast of Ireland, West England, West Ireland, West Scotland, Western Mediterranean
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In hollows in pools and crevices in the intertidal zone, also sublittoral to about 30 m depth, on stony ground and burrowing in the lithothamnion gravel (maerl). Once common in western Ireland, from Cork to Donegal, now depleted by commercial harvesting; very rare in Devon, Cornwall and the Islec of Scilly, occaional in the Channel Islannds, rare in western Scotland, around Skye and the smaller islands nearby
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Used to be found at a few sites in SW England but now very rare there. Still quite common on the west coast of Ireland but many good sites have been stripped of this urchin for export to France. Also found in a few localities off the west coast of Scotland such as Tiree.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Known from the nearshore.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 163 specimens in 1 taxon.
Water temperature and chemistry ranges based on 118 samples.

Environmental ranges
  Depth range (m): 0 - 53
  Temperature range (°C): 11.471 - 20.207
  Nitrate (umol/L): 0.729 - 7.121
  Salinity (PPS): 35.184 - 37.969
  Oxygen (ml/l): 5.144 - 6.200
  Phosphate (umol/l): 0.112 - 0.439
  Silicate (umol/l): 1.778 - 3.521

Graphical representation

Depth range (m): 0 - 53

Temperature range (°C): 11.471 - 20.207

Nitrate (umol/L): 0.729 - 7.121

Salinity (PPS): 35.184 - 37.969

Oxygen (ml/l): 5.144 - 6.200

Phosphate (umol/l): 0.112 - 0.439

Silicate (umol/l): 1.778 - 3.521
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 The purple sea urchin is found on the lower rocky shore in rock pools and into the shallow sublittoral down to depths of 3 m, but may be found deeper. It can also be found higher up on the middle/upper shore in rockpools e.g. in Scotland. It uses its spines and teeth to bore into soft rocks, its burrow providing protection from both wave action and desiccation at low tide. The urchin increases the size of its burrow as it grows. They are also sometimes found in beds of the seagrass Zostera spp.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Often in rock pools in limestone rocks where the animals live in hollows which just fit their bodies. Occasionally found in shallow water under rocks and rarely in deeper water to 30m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Breeding

Echinopluteus larva. Summer
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Paracentrotus lividus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGCAACTAAGACGATGACTATTTTCTACTAATCACAAGGACATTGGAACACTTTATTTAATTTTTGGTGCCTGAGCAGGCATGGTAGGAACTGCAATGAGAGTAATTATCCGAGCCGAACTAGCACAACCAGGGTCTTTATTGAAAGACGACCAAATTTACAAAGTAGTAGTTACTGCACACGCACTAGTAATGATTTTTTTTATGGTAATGCCAATTATGATAGGAGGATTTGGAAACTGACTTATCCCACTAATGATTGGAGCACCAGATATGGCCTTCCCCCGAATGAACAATATGAGATTCTGGTTAATCCCCCCTTCTTTTATTTTGCTTCTAGCCTCAGCAGGAGTAGAAAGAGGAGCCGGGACAGGATGAACCATATACCCCCCTCTCTCCAGAAAAATTGCCCACGCAGGAGGCTCAGTAGACTTAGCAATTTTCTCACTCCATCTTGCGGGTGCCTCTTCTATCCTAGCCTCAATTAACTTTATAACCACAATTATTAATATGCGAACGCCGGGAATGTCTTTTGACCGACTACCTTTGTTTGTTTGGTCCGTTTTTGTTACAGCATTCCTACTTCTTCTTTCTCTACCAGTACTAGCAGGAGCGATTACTATGCTTCTAACAGACCGTAAAATTAACACAACATTTTTCGACCCAGCAGGAGGAGGAGACCCAATTCTGTTTCAACATTTATTCTGATTTTTTGGTCACCCCGAAGTATATATTCTAATACTACCCGGATTTGGAATGATTTCACACGTAATAGCCCACTACTCAGGGAAGCGAGAACCTTTTGGATACCTGGGAATGGTCTACGCCATGATAGCGATCGGAGTCCTTGGATTCCTAGTTTGAGCTCACCATATGTTTACAGTTGGAATGGACGTAGACACACGAGCGTACTTTACAGCTGCCACAATGATAATAGCAGTACCCACAGGAATTAAGGTATTTAGATGAATGGCAACCCTTCAAGGATCTAACCTACAATGAGAAACTCCTCTACTATGAGCGCTCGGATTTGTCTTCTTATTCACCCTAGGCGGACTTACTGGAATTGTTCTAGCAAATTCTTCTATAGACGTAGTACTTCATGACACATACTACGTTGTTGCCCACTTTCACTATGTATTATCAATGGGTGCAGTATTCGCTATTTTTGCTGGGTTTACTCACTGGTTCCCACTATTTTGCGGATATAACTTACACCCTCTATGAGGAAAGGCTCACTTTTTTATGATGTTCGTTGGGGTCAACCTAACATTCTTCCCCCAACATTTCCTAGGTCTGGCTGGTATGCCACGGCGATACTCAGACTACCCAGATGCCTATACCCTCTGAAACACGGTTTCATCTATAGGATCAACTATTTCTTTGGTAGCCATGCTATTCTTTATTTTCCTAATTTGAGAAGCTTTCGCCTCTCAACGGGAAGGGGTTACCCCAGAATTTGCTAATGCCTCCCTGGAGTGGCAATACAACTCATTCCCCCCATCCCACCACACATTTGACGAAACACCTTCTACCGTAGTGATAGTTAAGTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Paracentrotus lividus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

IUCN Red List Category

Barcelona Convention Annex III (Species whose exploitation is regulated)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Paracentrotus lividus

Paracentrotus lividus is a species of sea urchin in the family Parechinidae commonly known as the purple sea urchin. It is the type species of the genus and occurs in the Mediterranean Sea and eastern Atlantic Ocean.[1]

Contents

Description

P. lividus has a circular, flattened greenish test with a diameter of up to seven centimetres. The test is densely clothed in long and sharply pointed spines that are usually purple but are occasionally other colours including dark brown, light brown and olive green. There are five or six pairs of pores on each ambulacral plate. The tube feet are in groups of 5 or 6, arranged in small arcs.[2]

Distribution

P. lividus is found throughout the Mediterranean Sea and in the eastern Atlantic Ocean from western Scotland and Ireland to the Azores, Canary Islands and Morocco. It is most common in the western Mediterranean, the coasts of Portugal and the Bay of Biscay, where the water temperature in winter varies between 10 and 15°C. [3]

Habitat

P. lividus is usually found just below low water mark at depths down to twenty metres and sometimes also in rock pools. It is found on rocks and boulders, and in seagrass meadows of Zostera marina and Posidonia oceanica. Although Cymodocea nodosa is a preferred food item, it is seldom found in meadows of this seagrass, perhaps because the shifting sand substrate does not suit it or because of pressure from predators. In fact it avoids soft substrates and can sometimes be found clustered on stones or shell "islands" surrounded by sand. In shallow or exposed waters it can use its mouth and spines to dig into soft rocks to create cavities into which it returns and in which it exactly fits. Where the urchins are numerous, the rock may be honeycombed by these excavations. Smaller individuals particularly use these retreats, which provide some protection from predators. In lagoons and rock pools, individuals are smaller than they are in the open sea. P. lividus is unable to tolerate low salinity. After exceptional quantities of rain fell in Corsica in the autumn of 1993, there was mass mortality of urchins in the Urbini Lagoon. However the urchin is relatively unaffected by organic pollution and heavy metals, in fact it flourishes near sewage outlets. There are wide swings in population densities over its range, which have not been completely explained.[3]

Biology

Individual P. lividus are either male or female although hermaphroditism has been observed. They aggregate for spawning and release gametes into the water column. The larvae form part of the zooplankton for about 28 days before settling and undergoing metamorphosis.[3]

Ecology

P. lividus is a browser, eating a range of red, green and brown algae in addition to seagrass. The benthic community is much affected by the number of urchins and their food preferences. Where they are numerous they tend to be surrounded by "barren ground" colonised by encrusting Corallinaceae species and characterised by a low biomass of primary producers with a small number of associated species. Where numbers are low, there tend to be forests of Laminaria and Cystoseira and a much richer, three dimensional community. The barren grounds can persist for years though whether this is due to overgrazing by urchins or prevention of recruitment of multicellular photosynthetic organisms by encrusting algae is unclear.[3]

Some juveniles of small fish species shelter among the spines. These include the clingfishes Apletodon incognitus and Lepadogaster candolii and the gobies, Gobius bucchichi, Zebrus zebrus and Millerigobius macrocephalus.[4]

The main predators on P. lividus in the Mediterranean Sea are the spider crab (Maja crispata), the fish Diplodus sargus, Diplodus vulgaris, Labrus merula and Coris julis and the gastropod, Hexaplex trunculus. The spiny starfish (Marthasterias glacialis) is a main predator elsewhere. Predation is dependent on size; juvenile urchins are more vulnerable as their spines are less formidable. In most locations the urchins are nocturnal feeders, but where predators are more active at night the urchins may feed during day instead.[3]

Use as food

Sea urchins roe in Alghero, Sardinia

The gonads are considered a delicacy in Italy and Spain, and are also eaten to a lesser extent in Greece. The urchins have been harvested for export over a wider area including Croatia, Portugal and Ireland.[3]

References

  1. ^ a b c Paracentrotus lividus (Lamarck, 1816) World Register of Marine Species. Retrieved 2011-08-23.
  2. ^ Purple sea urchin - Paracentrotus lividus Marine Life Information Network. Retrieved 2011-08-23.
  3. ^ a b c d e f Ecology of Paracentrotus lividus Google Books. Retrieved 2011-08-24.
  4. ^ Patzner, R. A. (1999) Sea urchins as hiding-place for juvenile benthic teleosts (Gobiidae and Gobiesocidae) in the Mediterranean Sea. Cybium 23.(1): 93-97.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!