Overview

Comprehensive Description

Biology/Natural History: One of the largest known ophiuroids, it can have a diameter of up to half a meter. It feeds on suspended particles by spreading its rays out like a fan, oriented mostly perpendicular to the current. Macroscopic zooplankton such as copepods, chaetognaths, and jellyfish are caught by microscopic hooks on the rays. The fine branchlet tips (see picture) then curl around the object and slowly move it toward the mouth (exact method is unclear). The prey of basket star species is said to range up to 3 cm (just over an inch) in size, and most basket stars capture prey mainly at night but may retain their prey until daytime to actually feed on them. Mucus may also help to immobilize prey. This species has also been reported to feed on the small benthic sea pen Stylatula elongata.

This species seems to have a strong co-occurrence with the soft coral Gersemia rubiformis. In Puget Sound, Gorgonocephalus juveniles have been reported within the pharynges of Gersemia polyps, where they appear to develop and apparently feed. The young do not leave the Gersemia until their rays are long enough to capture food.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Unlike any other local ophiuroid, the rays of the basket star branch repeatedly dichotomously. The central disk is covered with a loose-fitting skin with a dark brown color between the bases of the rays and a pinkish color, more similar to the ray color, near the ray bases. Actual color may be variable from tan, beige, orange-red, and pink to almost white; but the central disk is usually darker than the rays.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Beaufort Sea, Canadian part of the Arctic Ocean, European waters (ERMS scope), Gulf of St. Lawrence, North West Atlantic, United Kingdom Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Juveniles are known to live on, or in, the polyps of alvyonarians (Patent, 1970)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

lower North Shore; Prince Edward Island (from the northern tip of Miscou Island, N.B. to Cape Breton Island south of Cheticamp, including the Northumberland Strait and Georges Bay to the Canso Strait causeway)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographical Range: Bering Sea to Laguna Beach, CA, East Siberian Sea, Chukchi Sea, Japan, North Atlantic down to Massachusetts, Faeroe Islands.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

"On the west coast of North America from Alaska to California, the Bering Sea to the Sea of Japan, Okhotsk Sea, Laptev Sea, across the Arctic to Greenland, Finmark, Spitzbergen, and south to Cape Code; 8-1850 metres." (Lambert, Austin 2007)

Public Domain

Browne, Joy

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

"Disc: Up to 14 cm in diameter, indented between the radial shields and covered with thick skin. The radial shields taper towards the centre where they nearly meet with opposite shields; they are densely covered with scales bearing rough granules.

Arms: Branching and coiling at the tips, the arms are higher than their width in cross-section and have up to five lateral arm spines, four or fewer on distal branches. The spines have hooks with three teeth. Hooks are also borne on the vertical ridges of embedded plates on the dorsal and lateral arm surfaces.

Mouth: Contains spine-like teeth and oral papillae.

Colour: Usually tan with dark brown markings on the dorsal side of the disc, but throughout its range this species can be maroon, reddish, orange, salmon, pink and white." (Lambert, Austin 2007)

Public Domain

Browne, Joy

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

How to Distinguish from Similar Species: There are no other basket stars in the Rosario area.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

infralittoral and circalittoral of the Gulf and estuary
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 23 specimens in 1 taxon.
Water temperature and chemistry ranges based on 15 samples.

Environmental ranges
  Depth range (m): 54 - 1460
  Temperature range (°C): -1.315 - 8.165
  Nitrate (umol/L): 6.019 - 44.769
  Salinity (PPS): 32.056 - 34.983
  Oxygen (ml/l): 0.763 - 7.743
  Phosphate (umol/l): 0.821 - 3.254
  Silicate (umol/l): 5.390 - 160.825

Graphical representation

Depth range (m): 54 - 1460

Temperature range (°C): -1.315 - 8.165

Nitrate (umol/L): 6.019 - 44.769

Salinity (PPS): 32.056 - 34.983

Oxygen (ml/l): 0.763 - 7.743

Phosphate (umol/l): 0.821 - 3.254

Silicate (umol/l): 5.390 - 160.825
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth Range: Subtidal, 10 m to nearly 2000 m, most commonly 15-150 m.

Habitat: Usually on rocky bottoms with moderate to strong currents. Sometimes on sandy or muddy bottoms which have projecting boulders, sea fans, or sea pens.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

"Juveniles of this species inhabit the pharynx of the feeding polyps of the sea strawberry Gersemia up to a size of 0.5 cm disc diameter. At this stage they possibly intercept the food collected by the polyp. Later they can be found attached to adult basket stars while feeding on plankton. Up to five young were found clinging to an adult. As adults they attach to the substrate with some of their arms and extend the others into the water in a dish-like shape facing the current. Plankton caught by hooks on the arms are rolled up in strings of mucus, and then transferred to the mouth. In the stomach, prey are wrapped in bundles of mucus. Gorgonocephalus eucnemis eats mostly crustaceans and arrow worms with an occasional fish embryo or jellyfish. Without cilia on the arms, this species will not likely capture unicellular organisms." (Lambert, Austin 2007)

Public Domain

Browne, Joy

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

"The sex ratio of animals around the San Juan Islands is about 1:1, with 2.6 per cent hermaphrodites. The gonads grow during the summer, and spawning occurs from October to February. New gametes begin to form immediately after spawning, but development pauses until later in the cycle when final maturation takes place. This pause corresponds to a seasonal reduction in plankton density. Early larvae have no locomotory structures and they appear to be passively captured by Gersemia polyps, in which they being their life history. Animals grow rapidly up to a disc size of 5.5 cm." (Lambert, Austin 2007)

Public Domain

Browne, Joy

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gorgonocephalus eucnemis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACACTATACTTAATCTTTGGTGCTTGGGCTGGAACAGTAGGAACAGCAATGAGAAAAATTATTCGAGTAGAATTATCCCAACCAGGATCTTTAATCCAAAAAGACCAAACCTACAAAGTAATGGTTACATCTCATGCACTTATTATGATTTTCTTTATGGTAATGCCTATAATGATTGGAGGATTTGGAAAATGACTAGTCCCTTTGATGATAGGAGCTCCTGATATGGCATTCCCCCGAATGAAAAAAATGAGATTTTGACTAATACCACCTTCATTTTTACTTCTTCTAGCATCAGCTGGAAAAGAAAGAGGAGTTGGAACAGGATGAACTCTATACCCTCCATTATCTGGTCCTACAGCTCATAGAGGAGGCTGTGTTGATCTAGCAATTTTCTCTATTCACCTAGCAGGTGCTTCTTCAATAATGGCTTCAATAAATTTTATTTCAACTATTTTCAATATGCGAGCTCCAGGAATGAGATTAGACCGAACCCCTTTATTTGTATGATCTATATTAATAACCACATTCCTTTTATTATTATCCCTTCCTGTCCTTGCAGGAGCAATAACCATGCTTCTAACAGACCGAAAAATAAAAACCACATTTTTTGACCCTACTGGTGGAGGAGATCCAATTCTATTCCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Gorgonocephalus eucnemis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Gorgonocephalus eucnemis

Gorgonocephalus eucnemis is a species of basket star in the class Ophiuroidea. It is found in circumpolar marine environments in the Northern Hemisphere. The scientific name for the genus comes from the Greek, "gorgós" meaning "dreadful" and "cephalus" meaning "head", and refers to the similarity between these basket stars and the Gorgon's head from Greek mythology with its writhing serpents for hair.[2] The specific name "eucnemis" is from the Greek "good" and "boot".[3]

Contents

Description

Gorgonocephalus eucnemis has a central disc up to 14 centimetres (5.5 in) across with 5 pairs of arms that branch dichotomously into smaller and smaller subdivisions. The colour is varying shades of white and beige often with a darker disc. It has an endoskeleton of calcified ossicles and is covered in a fleshy layer of skin giving it a rubbery appearance. The arms are covered in tiny hooks and spines which can be used to grip and manipulate food particles.[2][4]

Distribution and habitat

Gorgonocephalus eucnemis is found in the Arctic Ocean[5] and northern parts of the Atlantic Ocean as far south as the Faeroe Islands and Massachusetts. It also occurs in the Pacific Ocean from the Bering Sea south to Japan and Laguna Beach, California. It is mostly found in rocky areas with strong currents at depths down to 2,000 metres (6,600 ft) but is most common at depths of 15 metres (49 ft) to 150 metres (490 ft). It is also found on mud and sandy seabeds among boulders, sea pens and sea fans.[6]

Biology

Gorgonocephalus eucnemis feeds by perching in an elevated position and extending its arms in a net-like fashion perpendicular to the current. The branches and branchlets twist and coil, making it resemble an animated bush.[6] It ensnares small crustaceans such as the northern krill (Meganyctiphanes norvegica), copepods, chaetognaths, jellyfish and detritus that come within reach. Trapped prey becomes the centre of a "knot" where it is immobilised by the secretion of mucus. Further coiling of the branches brings the food to the mouth which is on the underside of the central disc. Here the branchlets are passed through a comb-like structure which removes the food particles. There is no anus and any undigested fragments are expelled through the mouth.[2][4][6]

Individual basket stars are either male or female. After spawning the larvae become part of the plankton and disperse with the currents.[4]

Sanc1601 - Flickr - NOAA Photo Library.jpg

Ecology

Gorgonocephalus eucnemis is cryptic and remains well hidden during the day. It is protected by the toxic nature of the sponges where it lurks but is sometimes eaten by fish and crabs. It has been observed to return to a specific location regularly.[4]

It is often found living in association with sponges and soft corals in the genus Gersemia, hiding under them or in the folds of the sponges during the day and using them as elevated platforms for searching for prey at night.[4] In Puget Sound, juvenile Gorgonocephalus eucnemis have been found to be living and apparently feeding inside the pharynges of Gersemia rubiformis polyps, only emerging when sufficiently grown to fend for themselves.[6]

References

  1. ^ a b Stöhr, Sabine (2010). "Gorgonocephalus eucnemis (Müller & Troschel, 1842)". World Register of Marine Species. http://www.marinespecies.org/aphia.php?p=taxdetails&id=124969. Retrieved 2012-01-21.
  2. ^ a b c GORGONOCEPHALUS!! Because Weird is what we do! EchinoBlog. Retrieved 2012-01-21.
  3. ^ Genus Eucnemis BugGuide. Retrieved 2012-01-21.
  4. ^ a b c d e Gorgonocephalus eucnemis The Race Rocks Taxonomy. Retrieved 2012-01-22.
  5. ^ James A. Grieg, Report of the Second Norwegian Arctic Expedition in the "Fram" 1898-1902, No. 13, Vol. 2 Echinodermata 1907:3, 22ff; specimens found for the first time north and west of Baffin Bay, in Havne Fjord
  6. ^ a b c d Gorgonocephalus eucnemis Muller and Troschel, 1842 Walla Walla University. Retrieved 2012-01-22.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!