Articles on this page are available in 1 other language: Dutch (2) (learn more)

Overview

Comprehensive Description

General Description

Flustrellidra hispida is an encrusting bryozoan, generally restricted to the mid or lower intertidal zone, in temperate environments. It is abundant on sheltered to moderately exposed rocky shores, where it forms thick dark brown to purplish patches with a distinctly hairy or furry feel. It primarily colonises Fucus serratus, but may use other algal substrates such as Chondrus crispus, Gigartina stellata and Ascophyllum. Only very rarely does F. hispida colonise hard substrates.

The species is widely distributed and may be found on all British coasts.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Natural History Museum, London

Source: Bryozoa of the British Isles

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Gulf of St. Lawrence (unspecified region), lower St. Lawrence estuary, middle North Shore (from Sept- Iles to Cape Whittle, including the Cape Breton Channel); western slope of Newfoundland, including the southern part of the Strait of Belle Isle but excluding the upper 50m in the area southwest of Newfoundland; Cobscook Bay
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Belgian Coast, Belgian Exclusive Economic Zone, British Isles, Calais, Cobscook Bay, Deadmans Harbour, Dutch Exclusive Economic Zone, European waters (ERMS scope), Gulf of Maine, Holy Island, Irish Exclusive economic Zone, Klaverbank, North West Atlantic, Oosterschelde, Scheveningen, Schouwen, St. Lawrence Estuary, United Kingdom Exclusive Economic Zone, Wadden Sea, Wimereux, Zeebrugge, Zeeland
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Flustrellidra hispida is a temperate species. In the eastern Atlantic, it ranges from the White Sea and Arctic Norway to the north west coasts of France. In the western Atlantic it ranges south to Woods Hole

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Natural History Museum, London

Source: Bryozoa of the British Isles

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Fluestrellidra hispida forms thick encrusting patches or cylindrical colonies, which are dark brown to purple with a furry feel. Zooids are oval to hexagonal in shapes and are separated by deep grooves. Zooids are completely membranous with no calcification. The frontal membrane is smooth and translucent such that the polypide is visible as a white streak. The rectangular orifice of the zooid is subterminal and is wider than it is long. Tentacle number appears to vary between different populations, but is commonly between 28 and 40. Around four to six specialised zooids, which lack feeding apparatus, (kenozooids) develop as erect spines with a blister-like base. The spines are arranged in arc around the distal end (furthest from the colony origin) of feeding zooids and are typically between 0.4-0.6 mm long. They are responsible for the furry feel of the colony

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Natural History Museum, London

Source: Bryozoa of the British Isles

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

The size of zooids is between 0.8 and 1.2.6 by 0.5 and 0.6 mm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Natural History Museum, London

Source: Bryozoa of the British Isles

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Known from the nearshore.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

intertidal and infralittoral of the Gulf and estuary
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 51 specimens in 1 taxon.
Water temperature and chemistry ranges based on 6 samples.

Environmental ranges
  Depth range (m): 0 - 5
  Temperature range (°C): 11.471 - 12.348
  Nitrate (umol/L): 4.729 - 6.151
  Salinity (PPS): 35.184 - 35.363
  Oxygen (ml/l): 6.128 - 6.200
  Phosphate (umol/l): 0.336 - 0.421
  Silicate (umol/l): 2.315 - 3.285

Graphical representation

Depth range (m): 0 - 5

Temperature range (°C): 11.471 - 12.348

Nitrate (umol/L): 4.729 - 6.151

Salinity (PPS): 35.184 - 35.363

Oxygen (ml/l): 6.128 - 6.200

Phosphate (umol/l): 0.336 - 0.421

Silicate (umol/l): 2.315 - 3.285
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Flustrellidra hispida is abundant on sheltered to moderately exposed rocky shores. It reaches its greatest abundance on Fucus serratus, but may use other algal substrates such as Chondrus crispus, Gigartina stellata and Ascophyllum. Only very rarely does F. hispida colonise hard substrates. It is mainly found in the mid to lower shore, hardly extending into subtidal waters.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Natural History Museum, London

Source: Bryozoa of the British Isles

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Like all bryozoans, Flustrellidra hispida is a suspension feeder. It feeds on small phytoplankton using ciliated tentacles of the lophophore.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Natural History Museum, London

Source: Bryozoa of the British Isles

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Flustrellidra hispida is able to colonise algal substrates, primarily Fucus serratus, but it may use other algal substrates such as Chondrus crispus, Gigartina stellata and Ascophyllum.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Natural History Museum, London

Source: Bryozoa of the British Isles

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

The founding zooid (ancestrula) develops into a young colony, and later into an adult colony through asexual budding. Sexually produced embryos are brooded within the colony. Larvae settle after liberation and metamorphose into an ancestrula.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Natural History Museum, London

Source: Bryozoa of the British Isles

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction in Flustrellidra hispida occurs during winter. By February, developing embryos, brooded within the colony may be observed by the naked eye as distinct yellowish-white patches. Larvae are non-feeding coronate larvae, which lack a shell and have a densely ciliated belt (the corona) for locomotion. The larvae are large relative to other bryozoan larvae and settle from April to August, depending on location.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Natural History Museum, London

Source: Bryozoa of the British Isles

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Growth

Colonies grow through asexual budding of new zooids at the periphery. Growth of young colonies is rapid throughout the summer months.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Natural History Museum, London

Source: Bryozoa of the British Isles

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Flustrellidra hispida

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGCGATGATGAATATCTACAAACCACAAGGACATTGGAACACTTTATCTACTTTTCGGTTTATGATCTGGCATAGTGGGAAGCGCTTTTTCAGGTTTAATCCGAGCGGAACTAAGGCAAACAGGCTCACTCTTAGGGAAC---GACCAAATTTACAATGTAATCGTCACAGCACATGCATTCGTAATAATCTTTTTTATGGTTATGCCAGTGATAATCGGTGGCTTTGGTAACTGACTAGTTCCTGTCATACTAGGAGCCCCTGACATAGCATTCCCCCGTTTAAACAACATAAGTTTTTGACTACTCCCCCCCGCACTGTTTTTGCTGCTCCTTTCAAGGGTCGTTGAAGCTGGTGCTGGCACAGGATGAACAGTGTACCCACCACTGTCCTCACTAACAGCGCACTCTGGGGCCTCGGTAGACTTAGCAATTTTCTCTCTTCACCTTGCAGGTGCATCTTCTATCTTAGGAGCTATTAACTTTATGACCACTGTAATCAACATGCGCAGCAAAGCAATGACCGCCGCTCGAGTTCCCTTATTTGTGTGATCTGTTTTTATTACTGCTTTACTGCTAGTTTTATCCCTGCCTGTTCTTGCAGGAGCCATCACAATACTACTGACTGATCGAAACCTAAATACTACATTTTTCGACCCCAGGGGAGGCGGAGACCCCATCCTGTACCAGCACTTATTTTGATTTTTTGGACACCCCGAAGTATACATTCTTATTTTACCTGGTTTCGGTATGATCTCCCATGTAGTAGCCTCGTATAGAAACAAAGAAGAAGTATTTGGTACTGTCGGAATAATCTACGCTATACTCTCTATCGCTCTTTTGGGTTTTATTGTTTGAGCACATCATATATTTACTGTAGGGCTAGATGTCGACACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Flustrellidra hispida

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!