Overview

Distribution

Loppens (1906) beschouwt deze soort aan de Belgische kust als heel zeldzaam op wieren, voornamelijk op Fucus serratus. Er wordt geen vindplaats opgegeven, mogelijks vond hij ze enkel aangespoeld op het strand. Lacourt (1949) trof aangespoelde kolonies van Schouwen en Scheveningen aan in het ‘Rijksmuseum van Natuurlijke Historie’ in Leiden. Er zijn geen recente groeiplaatsen bekend uit België. Zelden spoelt een kolonie aan op plastic (De Blauwe, 2000c, 2005) en riemwiervoetjes. In Nederland slechts bekend van een beperkt aantal locaties in de Oosterschelde. In 2002 aangetroffen op de Klaverbank (pers. med. G. van Moorsel).
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Gulf of St. Lawrence (unspecified region), lower St. Lawrence estuary, middle North Shore (from Sept- Iles to Cape Whittle, including the Cape Breton Channel); western slope of Newfoundland, including the southern part of the Strait of Belle Isle but excluding the upper 50m in the area southwest of Newfoundland; Cobscook Bay
  • North-West Atlantic Ocean species (NWARMS)
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Description

Vormt soms uitgebreide, dikke, gelobde korsten op Fucus serratus en vlezige cilinders op Gigartina en Chondrus, soms op andere wieren. De kolonie is donker roodbruin en heeft een zacht uiterlijk. Kolonies kunnen twee jaar oud worden. In Nederland zijn de kolonies vrij dun en niet zo uitgebreid. Duikers zien vooral de uitstaande blauwachtig witte tentakelkransen. Zoïden groot, ovaal tot zeshoekig en convex. Frontaal glad, doorschijnend, de polypide als een witte streep. De subterminale spleetvormige opening is breder dan lang, met proximale en distale lip. Polypide relatief groot met veel tentakels (27 tot 40). Geelwitte embryo’s in februari. De 4 tot 6 typische, hoornachtige stekels rond de distale helft van elke zoïde zijn kenozoïden.
  • De Blauwe, H. (2009). Mosdiertjes van de Zuidelijke Bocht van de Noordzee. Determinatiewerk voor België en Nederland. Uitgave Vlaams Instituut voor de Zee, Oostende: 464pp.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

intertidal and infralittoral of the Gulf and estuary
  • North-West Atlantic Ocean species (NWARMS)
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 51 specimens in 1 taxon.
Water temperature and chemistry ranges based on 6 samples.

Environmental ranges
  Depth range (m): 0 - 5
  Temperature range (°C): 11.471 - 12.348
  Nitrate (umol/L): 4.729 - 6.151
  Salinity (PPS): 35.184 - 35.363
  Oxygen (ml/l): 6.128 - 6.200
  Phosphate (umol/l): 0.336 - 0.421
  Silicate (umol/l): 2.315 - 3.285

Graphical representation

Depth range (m): 0 - 5

Temperature range (°C): 11.471 - 12.348

Nitrate (umol/L): 4.729 - 6.151

Salinity (PPS): 35.184 - 35.363

Oxygen (ml/l): 6.128 - 6.200

Phosphate (umol/l): 0.336 - 0.421

Silicate (umol/l): 2.315 - 3.285
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

small microorganisms, including diatoms and other unicellar algae
  • North-West Atlantic Ocean species (NWARMS)
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Flustrellidra hispida

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGCGATGATGAATATCTACAAACCACAAGGACATTGGAACACTTTATCTACTTTTCGGTTTATGATCTGGCATAGTGGGAAGCGCTTTTTCAGGTTTAATCCGAGCGGAACTAAGGCAAACAGGCTCACTCTTAGGGAAC---GACCAAATTTACAATGTAATCGTCACAGCACATGCATTCGTAATAATCTTTTTTATGGTTATGCCAGTGATAATCGGTGGCTTTGGTAACTGACTAGTTCCTGTCATACTAGGAGCCCCTGACATAGCATTCCCCCGTTTAAACAACATAAGTTTTTGACTACTCCCCCCCGCACTGTTTTTGCTGCTCCTTTCAAGGGTCGTTGAAGCTGGTGCTGGCACAGGATGAACAGTGTACCCACCACTGTCCTCACTAACAGCGCACTCTGGGGCCTCGGTAGACTTAGCAATTTTCTCTCTTCACCTTGCAGGTGCATCTTCTATCTTAGGAGCTATTAACTTTATGACCACTGTAATCAACATGCGCAGCAAAGCAATGACCGCCGCTCGAGTTCCCTTATTTGTGTGATCTGTTTTTATTACTGCTTTACTGCTAGTTTTATCCCTGCCTGTTCTTGCAGGAGCCATCACAATACTACTGACTGATCGAAACCTAAATACTACATTTTTCGACCCCAGGGGAGGCGGAGACCCCATCCTGTACCAGCACTTATTTTGATTTTTTGGACACCCCGAAGTATACATTCTTATTTTACCTGGTTTCGGTATGATCTCCCATGTAGTAGCCTCGTATAGAAACAAAGAAGAAGTATTTGGTACTGTCGGAATAATCTACGCTATACTCTCTATCGCTCTTTTGGGTTTTATTGTTTGAGCACATCATATATTTACTGTAGGGCTAGATGTCGACACTCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Flustrellidra hispida

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!