Articles on this page are available in 1 other language: French (4) (learn more)

Overview

Comprehensive Description

Taxonomic History

1 subspecies

Atta geminata Fabricius, 1804: 423 (q.) CENTRAL AMERICA. AntCat AntWiki

Taxonomic history

Roger, 1862c PDF: 289 (w.m.); Mayr, 1867a PDF: 110 (w.q.m.); Wheeler, 1900b PDF: 21 (l.); Wheeler & Wheeler, 1955c PDF: 132 (l.); Crozier, 1970a PDF: 116 (k.).
Combination in Solenopsis: Mayr, 1863a PDF: 453.
respectively; of Solenopsis rufa (and its junior synonym Solenopsis diabola): Pheidologeton (Hymenoptera: Formicidae). Australian Journal of Zoology 14:73-171. [1966-02]">Ettershank, 1966 PDF: 141; of Solenopsis eduardi (and its junior synonym Solenopsis perversa), Solenopsis medusa (and its junior synonym Solenopsis bahiaensis), Solenopsis galapageia: Trager, 1991 PDF: 163.
See also: Smith, 1979: 1386.
Current subspecies: nominal plus Solenopsis geminata micans.
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Natural History:

Solenopsis geminata is the tropical fire ant. Fire ants are a group of related species, the Solenopsis geminata group, that has its center of diversity in southern South America. Solenopsis geminata is the only member of the group that occurs in Costa Rica, although it occurs in a "red form" that is more abundant in open areas and a "black form" that prefers forested areas. The environmental or genetic determinants of these forms are unknown.

Solenopsis geminata is most abundant in open sunny areas. It is common in agricultural areas and around human settlements. In the lowlands it is found not only in the open but may also penetrate into forest understory, albeit at lower density. At higher elevations it is restricted to open areas and does not extend into closed-canopy forest. There is anecdotal evidence that S. geminata occurrence in forest understory, even in mature forest habitats, is increasing, perhaps due to effects of fragmentation. Increased abundance in forest understory could be due to a greatly increased source population in the surrounding pasture areas, or to microclimate change that favors fire ant establishment in the forest understory.

Solenopsis geminata colonies are large, with tens to hundreds of thousands of workers. Nests are in the soil, usually in the form of a large exposed soil mound. Galleries extend out into the surrounding soil, surfacing at foraging zones at a distance from the nest. Most foraging is at the soil surface, but I have seen fire ants foraging several meters up on tree trunks or treefalls when there are abundant epiphytes and epiphytic soil. Workers form galleries extending from the ground up through the epiphytic soil.

Workers are generalized scavengers and they recruit rapidly to resources. Oil and protein sources, such as tuna baits, are particularly attractive. When large resources are discovered, workers often rapidly cover them with soil. I once observed S. geminata workers tending petiolar extrafloral nectaries at each leaf of a long Passiflora vine. The vine looped from the vegetation down to the ground for part of its length, and wherever a leaf petiole was touching the ground the ants had built a soil pavilion covering it.

Workers have powerful stings and are the bane of children running barefoot in the grass. If you mistakenly stand on a nest, workers will slowly cover your feet and lower legs and then all sting at once. Farmers generally despise them.

Individual colonies have large nuptial flights, with abundant males and alate queens issuing from nests. Workers swarm over the nest surface and surrounding vegetation, and they appear to be driving the males and alate queens from the nest. Nuptial flights do not seem highly syncronized among colonies and they may occur at any time of year.

Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Solenopsis geminata is a medium-sized reddish species with 10-segmented antennae, two-segmented antennal clubs, no antennal scrobes, nopropodeal spines, unsculptured heads and bodies, abundant thin and erect pilosity, and a polymorphic worker caste. The largest workers have disproportionately large and square-shaped heads. Like all myrmicines, S. geminata has a two-segmented waist and a gaster armed with a stinger.  Solenopsis geminata is commonly referred to as the Tropical Red Fire Ant. It is an aggressive species with a painful sting and is known to cause damage to ecological and agricultural systems. For a more complete review of the biology, impacts and management of S. geminata, users are referred to the IUCN/SSC Invasive Species Specialist Group (ISSG) web page. Although S. geminata is an unpleasant ant, it is preferable to S. invicta. If either species is collected during invasive ant surveys, it is highly recommended that specimens from each sample be identified under the microscope to confirm the identity.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Antkey

Source: Antkey

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

6. Solenopsis geminata, Fabr HNS .

(No. 48 a a 48 m). [[ worker ]] [[ queen ]] [[ male ]]. Espece cosmopolite des tropiques.

(48). Common, especially in open places below 1500 ft. The communities are large, often ten or twelve thousand individuals, I should think. The formicary proper is commonly excavated under sod or loose soil, advantage being often taken of the shelter afforded by a large stone, or by vines, a bush, & c; it is never far below the surface. In the centre is a large irregular chamber, or several small ones connected by very short passages; this central portion may occupy a space six inches square. From it a network of tunnels extends in all directions, but always near the surface; connected with these there may be other small chambers for larvae, food, & c. The longer tunnels may extend for many yards, commonly ending under stones, where other chambers are constructed; and to these distant parts of the formicarium the larvae are often carried. No matter how large the community is, there appears to be but one gravid female, though several winged females may be found. These ants are very pugnacious, especially when their central nest is disturbed. The sting is unpleasant, but not very painful. The largest-headed workers are. few in number, and keep to the inner passages of the formicarium. The other workers are frequently found about houses, on foliage, flowers, & c, and prowling over the ground in open places. They seem to live principally, if not entirely, on vegetable matter; they are especially fond of sweet substances. I have found considerable quantities of grass-seeds stored in small chambers in their nests. In their movements the smallheaded workers are moderately active; the large-headed ones move slowly, and in a staggering way. The females are sluggish.

(48 a). Near Wallibou (leeward); seashore thickets; sandy soil. Oct, 8 th. The main nest was under a large stone.

(48 b). Fitz-Hugh Valley (leeward), 500 ft.; open place near stream. A large nest under sod and vines on a rock.

(48 d). Fitz-Hugh Valley (leeward), 500 ft. Nov. 4 th. Open place. A female found alone in a small cavity of rotten wood.

(48 e). Golden Grove (leeward), 300 ft. June. Workers found about the house.

(48 f).. Workers from various localities on the leeward side and southern end of the island, below 1500 ft.; open places. Some found at the ends of their tunnels, under stones; others on foliage, on the flowers of Croton, & c.

(48 g). Southern end of the island; Villa Estate, near the seashore; dry hill-side; at the end of a tunnel under a stone. Oct. 14 th.

(48 h). Near Palmyra Estate (leeward), 1000 ft. Nov. 4 th. Open hill-side. A formicary or end of a tunnel, partly under a stone. The ants had formed a small mound at the side of the stone, with the earth brought up. I could find no female; and probably this was not the main nest, though the ants and larvae were numerous.

(48 i). Wallilobo (leeward), near sea-level; open valley. Nov. 8 th. From extensive passages under sod and stones.

(48 j). Camden Park Estate (leeward, near Kingstown), Nov. 19 th; seashore, at the root of a tree. A large colony. The ants had passages on the tree-trunk, following the lines of crevices, and formed roughly of bits of wood-fibre.

The tunnels of these ants are made very near the surface of the ground, and are generally partly open, either because the surface has fallen in, or because the passage is not necessarily a covered one; hence these passages can easily be traced.

(48 k). Nov. 23 rd. Golden Grove (leeward), 300 ft. Many thousands appeared in the upper room of the house, near sunset, in a corner near a window. They had at least a hundred males, which they let loose near the window. It was curious to see the workers drag the males to the window, which, however, was closed - a failure of instinct. Very few workers major appeared.

I killed thousands of the ants with carbolic acid. Notwithstanding this, and the fact that the window was an effectual barrier to swarming, the ants appeared again in a few days after, in the same place, with other males.

(481). Hermitage Estate, Cumberland Valley, 1000 ft.; open place. Dec. 2 nd. At roots of plants on a rock. A large nest.

(48 m). Windward coast of Robocca. Jan. 2 nd. Dooryard, under stones. (The species is common on the windward side).

N. B. - Mons. H. H. Smith a encore rapporte plusieurs [[ queen ]] et [[ male ]] appartenant au genre Solenopsis HNS , mais indeter- minables, parce que les [[ worker ]] correspondantes manquent.

II se peut qu'ils appartiennent a des [[ worker ]] deja decrites, et c'est un devoir de ne pas encombrer la synonymie de ce genre deja si difficile. Ces individus sont les numeros (10 h) [[ queen ]], (11 a) [[ queen ]] et [[ male ]], quatre especes de [[ male ]] pris au vol et sans numeros, enfin le No. 10 a. La [[ queen ]] et l'ouvriere du No. 10 a appartiennent a deux especes differentes, mais l'ouvriere unique, fort rapprochee de la S. Castor n'est pas assez caracteristique, ni assez bien conservee pour qu'il soit permis de la decrire.

(11). Perhaps referable to No. 9.

(11 a). Open place near sea-level; Cumberland Valley (leeward). Oct. 8 th. Flying. Copulated (about 8 a. m.).

  • Forel, A. (1893): Formicides de l'Antille St. Vincent. Récoltées par Mons. H. H. Smith. Transactions of the Entomological Society of London 1893, 333-418: 396-398, URL:http://research.amnh.org/entomology/social_insects/ants/publications/3948/3948.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Solenopsis geminata , F., var. rufa , Jerd HNS .,

♃ ☿ ♀. collected in March 1914, and kindly submitted to me by my friend Mr. D. Ward Pinkney

  • Crawley W. C. (1915): Ants from north and south-west Australia (G. F. Hill, Rowland Turner) and Christmas Island, Straits Settlements. Part 2. Ann. Mag Natur. Hist. 15, 232-239: 239-239, URL:http://antbase.org/ants/publications/6192/6192.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Solenopsis geminata (Fabricius HNS 1804).

Literature records: Cordillera, “Paraguay” (s. loc.) (Emery 1906, Forel 1906, Forel 1908b, Forel 1909).

Solenopsis geminata HNS is native from southern North Americs to northern South America (Trager 1991); records probably refer to S. saevissima HNS or S. macdonaghi HNS .

  • Wild, A. L. (2007): A catalogue of the ants of Paraguay (Hymenoptera: Formicidae). Zootaxa 1622, 1-55: 42-42, URL:http://www.antbase.org/ants/publications/21367/21367.pdf
Public Domain

Wild, A. L.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Canary Islands
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description


Diagnosis of worker among Antkey species. Worker caste polymorphic. Total length > 2 mm. Head ovoid (minors) to rectangular (majors). Antenna 10-segmented. Antennal club 2-segmented. Antennal scapes not conspicuously short; easily extended beyond eye level. Antennal insertions at least partly covered by frontal lobes; not surrounded by a raised sharp-edged ridge. Antennal scrobe lacking. Posterolateral corners of head unarmed, without spines. Eyes medium to large (greater than 5 facets); distinctly less than half length."" class=""lexicon-term"">head length. Frontal lobes do not obscure face outline between mandible and eye. Anterior margin of clypeus with two lateral teeth but lacking median tooth. Mandibles triangular. Pronotal spines absent. Propodeum lacking spines or teeth. Petiole with peduncle; "" class=""lexicon-term"">subpetiolar process not developed as a flange or lobe. Shiny yellowish to brownish red.


Solenopsis geminata is easily separated from S. papuana by the polymorphic worker caste, the greater size (TL > 2.0 mm), and by the larger eye (> 5 facets). It is most reliably separated from S. invicta and S. richteri by the absence of a median tooth between the two lateral teeth on the anterior margin of the clypeus. This character is often difficult to see, and it is best to examine a moderate sample of specimens of different sizes before a confident determination can be made. Solenopsis geminata is most easily distinguished from the North American native, S. xyloni, by the lack of a well-developed subpetiolar process that forms a flange or lobe.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Antkey

Source: Antkey

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Taxonomic Treatment

Forel, A., 1893:
 (No. 48 a a 48 m). [[ worker ]] [[ queen ]] [[ male ]]. Espece cosmopolite des tropiques.
 (48). Common, especially in open places below 1500 ft. The communities are large, often ten or twelve thousand individuals, I should think. The formicary proper is commonly excavated under sod or loose soil, advantage being often taken of the shelter afforded by a large stone, or by vines, a bush, & c; it is never far below the surface. In the centre is a large irregular chamber, or several small ones connected by very short passages; this central portion may occupy a space six inches square. From it a network of tunnels extends in all directions, but always near the surface; connected with these there may be other small chambers for larvae, food, & c. The longer tunnels may extend for many yards, commonly ending under stones, where other chambers are constructed; and to these distant parts of the formicarium the larvae are often carried. No matter how large the community is, there appears to be but one gravid female, though several winged females may be found. These ants are very pugnacious, especially when their central nest is disturbed. The sting is unpleasant, but not very painful. The largest-headed workers are. few in number, and keep to the inner passages of the formicarium. The other workers are frequently found about houses, on foliage, flowers, & c, and prowling over the ground in open places. They seem to live principally, if not entirely, on vegetable matter; they are especially fond of sweet substances. I have found considerable quantities of grass-seeds stored in small chambers in their nests. In their movements the smallheaded workers are moderately active; the large-headed ones move slowly, and in a staggering way. The females are sluggish.
 (48 a). Near Wallibou (leeward); seashore thickets; sandy soil. Oct, 8 th. The main nest was under a large stone.
 (48 b). Fitz-Hugh Valley (leeward), 500 ft.; open place near stream. A large nest under sod and vines on a rock.
 (48 d). Fitz-Hugh Valley (leeward), 500 ft. Nov. 4 th. Open place. A female found alone in a small cavity of rotten wood.
 (48 e). Golden Grove (leeward), 300 ft. June. Workers found about the house.
 (48 f).. Workers from various localities on the leeward side and southern end of the island, below 1500 ft.; open places. Some found at the ends of their tunnels, under stones; others on foliage, on the flowers of Croton, & c.
 (48 g). Southern end of the island; Villa Estate, near the seashore; dry hill-side; at the end of a tunnel under a stone. Oct. 14 th.
 (48 h). Near Palmyra Estate (leeward), 1000 ft. Nov. 4 th. Open hill-side. A formicary or end of a tunnel, partly under a stone. The ants had formed a small mound at the side of the stone, with the earth brought up. I could find no female; and probably this was not the main nest, though the ants and larvae were numerous.
 (48 i). Wallilobo (leeward), near sea-level; open valley. Nov. 8 th. From extensive passages under sod and stones.
 (48 j). Camden Park Estate (leeward, near Kingstown), Nov. 19 th; seashore, at the root of a tree. A large colony. The ants had passages on the tree-trunk, following the lines of crevices, and formed roughly of bits of wood-fibre.
 The tunnels of these ants are made very near the surface of the ground, and are generally partly open, either because the surface has fallen in, or because the passage is not necessarily a covered one; hence these passages can easily be traced.
 (48 k). Nov. 23 rd. Golden Grove (leeward), 300 ft. Many thousands appeared in the upper room of the house, near sunset, in a corner near a window. They had at least a hundred males, which they let loose near the window. It was curious to see the workers drag the males to the window, which, however, was closed - a failure of instinct. Very few workers major appeared.
 I killed thousands of the ants with carbolic acid. Notwithstanding this, and the fact that the window was an effectual barrier to swarming, the ants appeared again in a few days after, in the same place, with other males.
 (481). Hermitage Estate, Cumberland Valley, 1000 ft.; open place. Dec. 2 nd. At roots of plants on a rock. A large nest.
 (48 m). Windward coast of Robocca. Jan. 2 nd. Dooryard, under stones. (The species is common on the windward side).
  N. B. - Mons. H. H. Smith a encore rapporte plusieurs [[ queen ]] et [[ male ]] appartenant au genre Solenopsis , mais indeter- minables, parce que les [[ worker ]] correspondantes manquent.
 II se peut qu'ils appartiennent a des [[ worker ]] deja decrites, et c'est un devoir de ne pas encombrer la synonymie de ce genre deja si difficile. Ces individus sont les numeros (10 h) [[ queen ]], (11 a) [[ queen ]] et [[ male ]], quatre especes de [[ male ]] pris au vol et sans numeros, enfin le No. 10 a. La [[ queen ]] et l'ouvriere du No. 10 a appartiennent a deux especes differentes, mais l'ouvriere unique, fort rapprochee de la S. Castor n'est pas assez caracteristique, ni assez bien conservee pour qu'il soit permis de la decrire.
 (11). Perhaps referable to No. 9.
 (11 a). Open place near sea-level; Cumberland Valley (leeward). Oct. 8 th. Flying. Copulated (about 8 a. m.).
 

Emery, C., 1893:
 - Colombo.
 

Wild, A. L., 2007:
 Literature records: Cordillera, “Paraguay” (s. loc.) (Emery 1906, Forel 1906, Forel 1908b, Forel 1909).
 Solenopsis geminata is native from southern North Americs to northern South America (Trager 1991); records probably refer to S. saevissima or S. macdonaghi .
 

Santschi, F., 1915:
  [[ soldier ]]. Long. 2 - 4,3 mm. Jaune rougeatre ou brunatre; pattes, antennes et base du gastre d'un jaune roussatre; reste du gastre, moitie ou quart posterieur de la tete et mandibules d'un brun plus ou moins fonce. Pilosite et sculpture comme chez geminata , les cotes du thorax plus finement ponctues. Tete aussi longue que large (1,1 X 1,2 mm.), chez mon plus grand exemplaire, plus petite que chez geminata . Epistome quadridente, les dents externes tres petites, inserees a la base des internes. Premier n oe ud du pedicule un peu plus epais que chez le type, moins epais que chez S. Pylades For.
 [[ worker ]]. Comme chez le type, les dents externes de l'epistome sont peu sensibles. Mandibules striees, quadridentees, jaunatres. [[ queen ]]. Long. 7,5 mm. Quart posterieur de la tete, thorax, moins le bas
 des cotes, femurs, gastre, moins une tache triangulaire a la base et le bord des segments, d'un brun fonce; le reste roussatre ou jaune roussatre. Ailes hyalines, du reste comme le ' if. [[ male ]]. Long. 6,3 mm. Brun noiratre; sutures laterales et dessous du thorax, mandibules, pattes et antennes d'un jaune plus ou moins terne. Lisse et luisant.
 Gabon: Samkita (F. Fahre, 1914), [[ male ]], [[ soldier ]], [[ worker ]], [[ queen ]] - — Liberia: Monrovia (Delafosse, Museum de Paris, [[ worker ]]). — Congo: Ngoma (Galli-Valerio), [[ worker ]].
 C'est probablement une variete importee d'Amerique, ou l'espece est tres repandue. Elle parait se developper tres rapidement en Afrique, et M. F. Faure m'ecrit que ces fourmis sont tres nuisibles dans les plantations.
  [[ worker ]]. Long. 1,6 mm. Jaune tesface et mat, appendices et gastre d'un jaune plus clair, lisses et luisants. Tete et thorax tres finement reticules. Sur le dessus de la tete qui est submat, les reticulations ont une tendance nettement longitudinale avec une " assez grosse ponctuation pilifere espacee ( M. Pharaonis est plus grossierement et plus regulierement ponctue-reticule). Une fine pilosite inclinee assez abondante sur la tete, les antennes et le gastre, plus rare ailleurs.
  Tete rectangulaire, d'un cinquieme au moins plus longue que large, les cotes et le bord posterieur faiblement arques. Yeux en avant du milieu des cotes et assez convexes. Les scapes n'atteignent pas le bord posterieur (ils le depassent chez M. Pharaonis ). Articles 3 a 8 du funicule plus epais que longs, les articles 9 et 10 un peu plus longs qu'epais (beaucoup plus longs, chez M. Pharaonis ). Cretes frontales plus rapprochees que chez M. Pharaonis . Carenes de l'epistome mousses et un peu divergentes, le bord anterieur de celui-ci faiblement echancre au milieu. Mandibules striolees, de 3 dents (4?). Promesonotum d'un quart plus long que large, sans sutures dorsales et assez peu convexe. Face basale de l'epinotum un peu plus basse, droite, plane, plus longue que large, presque le double plus longue que la face declive, qui est subverticale et vers laquelle elle passe par un angle arrondi. Premier n oe ud du pedicule aussi haut que long, plus brievement petiole en avant que chez M. Pharaonis . Deuxieme article un peu plus large que le premier; devant du gastre faiblement echancre. Tres voisin de M. Pharaonis , bien que different par ses antennes, sa taille et sa sculpture.
 Afrique Orientale anglaise: Bura
 (Gh. Alluaud et R. Jeahnel), 1 [[ worker ]].
 

Santschi, F., 1913:
 — [[ worker ]]. [[ soldier ]] [[ queen ]]. Gabon (F. Faure) [[ worker ]]. Liberia. — Probablement importee d'Amerique sur les cotes africaines, cette espece, tres guerriere, risque fort d'avoir une grande extension en Afrique. Sur certaines Antilles, elle s'est substituee aux especes locales.
 

Forel, A., 1908:
 [[ worker ]] [[ queen ]] [[ male ]]. Zent, cote Atlantique, Costa Rica (Biolley), tres grandes [[ worker ]] major; Ile de Coco (Alfaro), probablement importee.
 [[ worker ]]. L, 2,2 a 4,5 mill. Entierement noire, sauf les tarses, les articulations, les funicules et le devant de la tete de la [[ worker ]] maxima qui sont roussatres. Tete plus fortement et plus abondamment ponctuee que chez le type de l'espece.
  Zent, cote Atlantique de Costa Rica, dans un stipe de palmier (P. Biolley). M. Wheeler ayant denomme les varietes americaines jaunatres ( diabola et aurea ) de la S. geminata , je crois necessaire de baptiser l'extreme inverse qui se distingue en outre par sa ponctuation plus forte.
 
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Literature records: Cordillera, “Paraguay” (s. loc.) (Emery 1906, Forel 1906, Forel 1908b, Forel 1909).

 

Solenopsis geminata is native from southern North Americs to northern South America (Trager 1991); records probably refer to S. saevissima or S. macdonaghi .

License not applicable

Wild, A. L.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

[[ worker ]]. Long. 1,6 mm. Jaune tesface et mat, appendices et gastre d'un jaune plus clair, lisses et luisants. Tete et thorax tres finement reticules. Sur le dessus de la tete qui est submat, les reticulations ont une tendance nettement longitudinale avec une " assez grosse ponctuation pilifere espacee ( M. Pharaonis est plus grossierement et plus regulierement ponctue-reticule). Une fine pilosite inclinee assez abondante sur la tete, les antennes et le gastre, plus rare ailleurs.

 

Tete rectangulaire, d'un cinquieme au moins plus longue que large, les cotes et le bord posterieur faiblement arques. Yeux en avant du milieu des cotes et assez convexes. Les scapes n'atteignent pas le bord posterieur (ils le depassent chez M. Pharaonis ). Articles 3 a 8 du funicule plus epais que longs, les articles 9 et 10 un peu plus longs qu'epais (beaucoup plus longs, chez M. Pharaonis ). Cretes frontales plus rapprochees que chez M. Pharaonis . Carenes de l'epistome mousses et un peu divergentes, le bord anterieur de celui-ci faiblement echancre au milieu. Mandibules striolees, de 3 dents (4?). Promesonotum d'un quart plus long que large, sans sutures dorsales et assez peu convexe. Face basale de l'epinotum un peu plus basse, droite, plane, plus longue que large, presque le double plus longue que la face declive, qui est subverticale et vers laquelle elle passe par un angle arrondi. Premier n oe ud du pedicule aussi haut que long, plus brievement petiole en avant que chez M. Pharaonis . Deuxieme article un peu plus large que le premier; devant du gastre faiblement echancre. Tres voisin de M. Pharaonis , bien que different par ses antennes, sa taille et sa sculpture.

 

Afrique Orientale anglaise: Bura

 

(Gh. Alluaud et R. Jeahnel), 1 [[ worker ]].

License not applicable

Santschi, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

— [[ worker ]]. [[ soldier ]] [[ queen ]]. Gabon (F. Faure) [[ worker ]]. Liberia. — Probablement importee d'Amerique sur les cotes africaines, cette espece, tres guerriere, risque fort d'avoir une grande extension en Afrique. Sur certaines Antilles, elle s'est substituee aux especes locales.

License not applicable

Santschi, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

- Colombo.

License not applicable

Emery, C.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

(No. 48 a a 48 m). [[ worker ]] [[ queen ]] [[ male ]]. Espece cosmopolite des tropiques.

 

(48). Common, especially in open places below 1500 ft. The communities are large, often ten or twelve thousand individuals, I should think. The formicary proper is commonly excavated under sod or loose soil, advantage being often taken of the shelter afforded by a large stone, or by vines, a bush, & c; it is never far below the surface. In the centre is a large irregular chamber, or several small ones connected by very short passages; this central portion may occupy a space six inches square. From it a network of tunnels extends in all directions, but always near the surface; connected with these there may be other small chambers for larvae, food, & c. The longer tunnels may extend for many yards, commonly ending under stones, where other chambers are constructed; and to these distant parts of the formicarium the larvae are often carried. No matter how large the community is, there appears to be but one gravid female, though several winged females may be found. These ants are very pugnacious, especially when their central nest is disturbed. The sting is unpleasant, but not very painful. The largest-headed workers are. few in number, and keep to the inner passages of the formicarium. The other workers are frequently found about houses, on foliage, flowers, & c, and prowling over the ground in open places. They seem to live principally, if not entirely, on vegetable matter; they are especially fond of sweet substances. I have found considerable quantities of grass-seeds stored in small chambers in their nests. In their movements the smallheaded workers are moderately active; the large-headed ones move slowly, and in a staggering way. The females are sluggish.

 

(48 a). Near Wallibou (leeward); seashore thickets; sandy soil. Oct, 8 th. The main nest was under a large stone.

 

(48 b). Fitz-Hugh Valley (leeward), 500 ft.; open place near stream. A large nest under sod and vines on a rock.

 

(48 d). Fitz-Hugh Valley (leeward), 500 ft. Nov. 4 th. Open place. A female found alone in a small cavity of rotten wood.

 

(48 e). Golden Grove (leeward), 300 ft. June. Workers found about the house.

 

(48 f).. Workers from various localities on the leeward side and southern end of the island, below 1500 ft.; open places. Some found at the ends of their tunnels, under stones; others on foliage, on the flowers of Croton, & c.

 

(48 g). Southern end of the island; Villa Estate, near the seashore; dry hill-side; at the end of a tunnel under a stone. Oct. 14 th.

 

(48 h). Near Palmyra Estate (leeward), 1000 ft. Nov. 4 th. Open hill-side. A formicary or end of a tunnel, partly under a stone. The ants had formed a small mound at the side of the stone, with the earth brought up. I could find no female; and probably this was not the main nest, though the ants and larvae were numerous.

 

(48 i). Wallilobo (leeward), near sea-level; open valley. Nov. 8 th. From extensive passages under sod and stones.

 

(48 j). Camden Park Estate (leeward, near Kingstown), Nov. 19 th; seashore, at the root of a tree. A large colony. The ants had passages on the tree-trunk, following the lines of crevices, and formed roughly of bits of wood-fibre.

 

The tunnels of these ants are made very near the surface of the ground, and are generally partly open, either because the surface has fallen in, or because the passage is not necessarily a covered one; hence these passages can easily be traced.

 

(48 k). Nov. 23 rd. Golden Grove (leeward), 300 ft. Many thousands appeared in the upper room of the house, near sunset, in a corner near a window. They had at least a hundred males, which they let loose near the window. It was curious to see the workers drag the males to the window, which, however, was closed - a failure of instinct. Very few workers major appeared.

 

I killed thousands of the ants with carbolic acid. Notwithstanding this, and the fact that the window was an effectual barrier to swarming, the ants appeared again in a few days after, in the same place, with other males.

 

(481). Hermitage Estate, Cumberland Valley, 1000 ft.; open place. Dec. 2 nd. At roots of plants on a rock. A large nest.

 

(48 m). Windward coast of Robocca. Jan. 2 nd. Dooryard, under stones. (The species is common on the windward side).

 

N. B. - Mons. H. H. Smith a encore rapporte plusieurs [[ queen ]] et [[ male ]] appartenant au genre Solenopsis , mais indeter- minables, parce que les [[ worker ]] correspondantes manquent.

 

II se peut qu'ils appartiennent a des [[ worker ]] deja decrites, et c'est un devoir de ne pas encombrer la synonymie de ce genre deja si difficile. Ces individus sont les numeros (10 h) [[ queen ]], (11 a) [[ queen ]] et [[ male ]], quatre especes de [[ male ]] pris au vol et sans numeros, enfin le No. 10 a. La [[ queen ]] et l'ouvriere du No. 10 a appartiennent a deux especes differentes, mais l'ouvriere unique, fort rapprochee de la S. Castor n'est pas assez caracteristique, ni assez bien conservee pour qu'il soit permis de la decrire.

 

(11). Perhaps referable to No. 9.

 

(11 a). Open place near sea-level; Cumberland Valley (leeward). Oct. 8 th. Flying. Copulated (about 8 a. m.).

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

[[ worker ]] [[ queen ]] [[ male ]]. Zent, cote Atlantique, Costa Rica (Biolley), tres grandes [[ worker ]] major; Ile de Coco (Alfaro), probablement importee.

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

Solenopsis invicta, Solenopsis richteri, Solenopsis xyloni

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Antkey

Source: Antkey

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

Known prey organisms

Solenopsis geminata preys on:
Anaides
Coilodes castanea
Deltochilum lobipes
Eurysternus caribaeus
Eurysternus caludicans
Eurysternus plebejus
Onthophagus praecellens
toad carrion

Based on studies in:
Costa Rica: de Osa (Carrion substrate)

This list may not be complete but is based on published studies.
  • B. W. Cornaby, 1974. Carrion reduction by animals in contrasting tropical habitats. Biotropica 6:51-63, from pp. 54, 59-62.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Solenopsis geminata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 29
Specimens with Barcodes: 100
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Solenopsis geminata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 26 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTTTATATTTTATTCTTGCAATTTGAGCAGGAATAATTGGTTCTTCTATAAGAATAATCATTCGATTAGAACTAGGATCTTGCAACTCTCTAATTAATAACGATCAAATCTACAACTCCCTAGTTACCAGACATGCTTTTATTATAATTTTTTTCATAGTTATACCTTTTATAATTGGAGGATTTGGAAATTTTCTAGTCCCTCTAATATTAGGATCCCCAGATATAGCCTACCCCCGAATAAATAACATAAGATTCTGACTCCTACCCCCTTCCCTAACTCTTTTAATTATTAGAAGATTTATTAACAGCGGGGTAGGTACAGGCTGAACTATTTATCCACCCCTAGCATCTAATATTTTTCACAGGGGAGCCTCTATTGACCTCTCAATTTTCTCTCTTCATATTGCCGGAATATCATCAATTCTTGGGGCCATTAATTTTATCTCCACTATTATTAACATACACCATAAAAATTTTACTATAGATAAAATTCCTCTTTTAGTCTGATCTATCCTTATCACTGCTATTTTACTCCTACTTTCCCTACCTGTTCTGGCTGGGGCTATTACCATATTACTAACTGACCGTAATTTAAATACTTCTTTCTTCGATCCCTCAGGTGGCGGCGATCCAATCCTATACCAACATCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!