Overview

Distribution

Distribution: Florida, Java, Sandwich-Islands, Gesellschafts-Islands (Selenka, 1867).
  • Selenka, E. (1867). Beitrage zur Anatomie und Systematik der Holothurien. Der Philosophischen Facultat zu Gottingen in December 1866, als Dissertation vorgelegt.: pp. 291-374.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is found in the Gulf of Mexico, Cuba, Florida (USA), Bahamas, Puerto Rico, Aruba, Jamaica, Lesser Antilles, Honduras, Colombia and Panama (Hendler et al. 1995, Alvarado 2010).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In Panama this species has been collected from Galeta Point (reef West of lab), Galeta Island (USNM E 24001, USNM E 24001), from Miria Island, (USNM E 21671, USNM E 21679, USNM E 21673, USNM E 21683, USNM E 21709), Pico Feo Island (USNM E 22477), San Blas Islands, and from North of Palina Island (USNM E 52888; Centroid Latitude: 9.61306, Centroid Longitude: -79.59722), Colon, Caribbean Sea.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Coppard , Simon

Source: The Echinoderms of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Diagnostic Description

References and links

Pourtalès, L. F. (1851). On the Holothuriae of the Atlantic Coast of the United States. Proceedings American Association Advancement Science, Fifth Meeting, Washington. pp. 8-16.

Selenka, E. (1867). Beiträge zur Anatomie und Systematik der Holothurien, Z. wiss. Zool. 17: 291-374, pls. 17-20.

World Register of Marine Species

LSID urn:lsid:marinespecies.org:taxname:210900


Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Coppard , Simon

Source: The Echinoderms of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Synonymised taxa

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Coppard , Simon

Source: The Echinoderms of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found in seagrass beds, tidepools and mangrove swamps (Hendler et al. 1995). The length is between 20-51cm. The weight at maturity is 28.5g (male) and 22g (female) (Engstrom 1980).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 6 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 1 - 1207
  Temperature range (°C): 4.868 - 26.658
  Nitrate (umol/L): 0.632 - 20.333
  Salinity (PPS): 35.020 - 36.130
  Oxygen (ml/l): 4.583 - 5.576
  Phosphate (umol/l): 0.085 - 1.289
  Silicate (umol/l): 2.068 - 13.283

Graphical representation

Depth range (m): 1 - 1207

Temperature range (°C): 4.868 - 26.658

Nitrate (umol/L): 0.632 - 20.333

Salinity (PPS): 35.020 - 36.130

Oxygen (ml/l): 4.583 - 5.576

Phosphate (umol/l): 0.085 - 1.289

Silicate (umol/l): 2.068 - 13.283
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Holothuria floridana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AAATGACTAATACCATTAATG---ATCGGAGCCCCTGACATGGCTTTCCCTCGGATGAAAAACATGAGTTTCTGACTAGTCCCACCCTCTTTTATACTACTCCTTGCCTCAGCAGGAGTAGAAAGAGGTGCTGGAACAGGATGGACTATTTATCCCCCTCTATCAAGAAACATAGCCCACGCTGGAGGATCAGTAGACCTA---GCTATTTTTTCTTTACATCTAGCAGGAGCTTCATCAATACTAGCCTCAATAAACTTCATAACAACAATAATAAAAATGCGAACCCCGGGTGTTACCTTTGACCGACTTCCATTATTTGTGTGATCCGTATTTATAACAGCATTTCTACTACTTCTAAGACTACCCGTTCTAGCAGGA---GCAATCACAATGCTCCTAACCGATCGAAATATTAAAACTACATTCTTTGACCCAGCTGGGGGAGGAGATCCAATACTATTCCAACACCTCTTCTGATTCTTCGGACATCCAGAAGTTTACATCCTCATTCTACCCGGATTCGGAATGATATCCCATGTAATAGCTCACTACAGAGGAAAGCAA---GAGCCCTTTGGATACCTAGGGATGGTATATGCAATGGTCGCAATCGGAATCCTCGGATTCCTAGTATGAGCCCACCACATGTTCACCGTCGGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Holothuria floridana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
Alvarado, J.J., Paola Ortiz, E., Benavides, M. & Toral-Granda, T.-G.

Reviewer/s
Polidoro, B., Carpenter, K.E., Knapp, L. & Harwell, H.

Contributor/s

Justification
This species is widely distributed. It is not well known, however it is does not appear to be fished. The only potential threat is loss of habitat and pollution due to coastal development. More research is needed on its distribution, ecology, and abundance. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In Banco Chinchorro, Mexico, densities were between 0-0.12ind*m2 and a mean stock density of 21ind*ha-1 were found (Fuente-Betancourt et al. 2001).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
This species may accumulate high levels of trace metals, including cadmium, chrome, copper, and lead, which may be a concern to human consumption (Medina-Gonzalez et al. 2004). There may also be concerns over loss of habitat in areas of high coastal development.
A preliminary study conducted on this species found that it can be extracted for commercial purposes, and that a quota of 50% of MSY (maximum sustainable yield) should be used. The fishery should also be suspended after severe weather events, such as hurricanes (Fuentes-Betancourt et al. 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known species specific conservation measures for this species. More research is needed on its distribution, ecology, and abundance.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Holothuria floridana

Holothuria floridana, the Florida sea cucumber, is a species of marine invertebrate in the family Holothuriidae. It is found on the seabed just below the low tide mark in Florida, the Bahamas and the Caribbean.

Contents

Description

The Florida sea cucumber can grow to a length of up to 8 inches (200 mm). It has an elongated cylindrical shape with a tough, leathery skin with blunt conical protuberances. On the underside it has several rows of short tube feet. On one end is the mouth surrounded by a ring of feeding tentacles. The body colour is mottled brown, fawn and white.[2]

Distribution and habitat

The Florida sea cucumber is found at depths of up to 5 metres (16 ft) on sand and on seagrass beds in the Caribbean Sea, Gulf of Mexico and the coasts of Florida.[3]

Biology

The Florida sea cucumber moves across the sandy seabed sifting through the sand with its tentacles and feeding on detritus and other organic particles.[3]

References

  1. ^ Paulay, Gustav (2012). "Holothuria (Halodeima) floridana Pourtalés, 1851". World Register of Marine Species. http://www.marinespecies.org/aphia.php?p=taxdetails&id=210900. Retrieved 2012-06-11.
  2. ^ Florida Sea Cucumber Florent's guide to the tropical reefs. Retrieved 2012-06-11.
  3. ^ a b Holothuria floridana Saltcorner. Retrieved 2011-06-11.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!