Articles on this page are available in 1 other language: French (4) (learn more)

Overview

Comprehensive Description

Plagiolepis alluaudi Emery HNS 1894b

I [introduced species]

  • Ward, P. S. (2005): A synoptic review of the ants of California (Hymenoptera: Formicidae). Zootaxa 936, 1-68: null, URL:http://antbase.org/ants/publications/21008/21008.pdf
Public Domain

Ward, P. S.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Taxonomic History

Plagiolepis alluaudi Emery, 1894b PDF: 71 (w.) SEYCHELLES IS. AntCat AntWiki

Taxonomic history

Forel, 1907d PDF: 30 (q.).
Senior synonym of Plagiolepis augusti, Plagiolepis foreli, Plagiolepis mactavishi, Plagiolepis ornata: Smith, 1958b PDF: 196.
See also: Smith, 1979: 1423.
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Reference for Kenya if not type: Santschi 1920d (as foreli, a synonyn)
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Taxonomic Treatment

Forel, A., 1912:
 [[ worker ]]. Seychelles: Silhouette, Mare aux Cochons; Felicite.
 

Ward, P. S., 2005:
 I [introduced species]
 

Forel, A., 1895:
 - Identique a celle des Seychelles.
 

Emery, C., 1894:
  - [[ worker ]]. Tres voisine de P. pygmaea et P. madecassa , dont elle a la sculpture et la pubescence; se distingue par sa forme plus elancee et par la suture mesometanotale entierement effacee sur le dos. la partie du mesonotum situee derriere l'etranglement etant continue avec le metanotum. Couleur testace clair, les pattes et antennes pales; l'extremite des antennes a peine un peu rembrunie chez certains exemplaires. - Long. 1 1 / 4 - 1 1 / 3 mill.
 Mahe: La Misere.
 

Forel, A., 1907:
 [[ worker ]]. Ile Farquhar. Espece des Seychelles retrouvee plus tard dans les serres chaudes de Berne, ou elle a ete importee.
 
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

I [introduced species]

License not applicable

Ward, P. S.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

- [[ worker ]]. Tres voisine de P. pygmaea et P. madecassa , dont elle a la sculpture et la pubescence; se distingue par sa forme plus elancee et par la suture mesometanotale entierement effacee sur le dos. la partie du mesonotum situee derriere l'etranglement etant continue avec le metanotum. Couleur testace clair, les pattes et antennes pales; l'extremite des antennes a peine un peu rembrunie chez certains exemplaires. - Long. 1 1 / 4 - 1 1 / 3 mill.

 

Mahe: La Misere.

License not applicable

Emery, C.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

- Identique a celle des Seychelles.

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

[[ worker ]]. Ile Farquhar. Espece des Seychelles retrouvee plus tard dans les serres chaudes de Berne, ou elle a ete importee.

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

[[ worker ]]. Seychelles: Silhouette, Mare aux Cochons; Felicite.

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Plagiolepis alluaudi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATTTTATACTTTTTATTTGCAATTTGAGCAGGAATATTAGGCTCATCTATAAGAATAATTATCCGTTTAGAACTAGGATCTCCTAATGCCCTAATCAATAATGATCAAATCTACAACTCAATAGTTACAAGACATGCATTTATTATAATTTTCTTTATAGTTATGCCCTTCATAATTGGCGGATTTGGAAACTTCCTAATTCCTCTAATAATTGGATCACCAGATATAGCTTATCCTCGTATAAATAACATAAGATTTTGACTCCTTCCCCCCTCTATTTCCCTCTTACTCTTAAGAAATTTTATTAATGATGGTGTCGGAACAGGATGGACTATTTATCCTCCTTTAGCCTCTAATATCTTTCATAATGGACCTTCAGTTGACTTAACTATCTTCTCTCTTCACATCGCTGGAATATCTTCAATCTTAGGGGCTATCAATTTTATTTCAACTATTCTAAATATACATCACAAACACCTCTCCATGGATAAAATTCCCCTTTTAGTTTGATCAATTTTTATTACAGCTATCCTACTCCTTCTCTCCCTTCCTGTCTTGGCAGGGGCAATCACTATACTTTTAACTGATCGTAACTTAAATACCTCCTTTTTCGACCCTTCAGGAGGAGGTGATCCAATTTTATACCAACACTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Plagiolepis alluaudi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 135
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!