Overview

Comprehensive Description

Taxonomic History

Formica badia Latreille, 1802a: 238, pl. 11, fig. 71 (w.q.) U.S.A. AntCat AntWiki

Taxonomic history

Lepeletier, 1835: 175 (m.); Wheeler & Wheeler, 1960b PDF: 2 (l.); Taber, Cokendolpher & Francke, 1988 PDF: 51 (k.).
Combination in Aphaenogaster: Roger, 1863b PDF: 30; in Pogonomyrmex: Mayr, 1870b PDF: 971.
Senior synonym of Pogonomyrmex transversa (and its junior synonyms Pogonomyrmex brevipennis, Pogonomyrmex crudelis): Emery, 1895d PDF: 310.
See also: Cole, 1968: 148; Gordon, 1984: 413; Hölldobler & Wilson, 1971: 385; Smith, 1979: 1356.
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Known from Florida to North Carolina and west into Mississippi and Louisiana.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pogonomyrmex badius

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATAATCATTCGCCTTGAACTCGGTTCATGTAATAGTTTAATTAATAAT---GAACAAATCTACAATTCTATAGTAACAAGACATGCATTTATTATAATTTTTTTTATAGTTATACCCTTCATAATTGGTGGTTTTGGGAATTTTCTTGTCCCATTAATA---CTTGGAACACCTGATATAGCATTTCCTCGAATAAATAATATAAGATTTTGACTCCTTCCACCATCAATTTCCTTATTAATTTTAAGAAACTTTATTGGAAGAGGTGTTGGGACTGGTTGAACTATTTATCCTCCTCTTGCCTCAAATATTTTTCATAGAGGCCCTTCAATTGATATATCT---ATTTTCTCTTTGCATATTGCCGGTATATCATCAATTCTTGGAGCAATTAATTTTATTACAACAATTTTAAATATACATCATAAAAATTTTACTATAGATAAAATTCCTCTTTTAGTATGATCTATTCTAATTACCGCAATCCTTTTATTATTATCCCTTCCAGTACTTGCTGGA---GCAATTACCATATTATTAACTGATCGAAACTTAAATACTACATTTTTTGATCCGAGGGGAGGGGGAGATCCTATTTTATATCAACATTTATTTTGATTTTTTGGACACCCCGAAGTTTATATTCTTATTCTACCTGGATTTGGATTAATTTCACATATTATTATAAATGAAAGGGGGAAAAAA---GAAACTTTTGGCTCTTTAGGTATAATTTATGCAATAATCGCAATTGGATTTTTAGGTTTTATTGTATGAGCTCACCATATATTTACAATCGGATTAGATGTAGATACCCGAGCTTACTTCACCTCAGCTACAATAATTATTGCAATTCCAACTGGTATTAAAATTTTTAGATGAATTTCC---ACGCTTCATGGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pogonomyrmex badius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!