Overview

Distribution

Virginian, southside of Cape Cod to Cape Hatteras
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species is recorded from the Caribbean coast of Panama (Alvarado et al. 2008).

Alvarado, J.J., F.A. Solis-Marin & C. Ahearn. (2008). Equinodermos (Echinodermata) del Caribe Centroamericano. Rev.Biol.Trop. 56 (Suppl. 3): 37-55.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Coppard , Simon

Source: The Echinoderms of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

References and links

Clark, A. M. & Downey, M. E. (1992). Starfishes of the Atlantic. Chapman & Hall Identification Guides, 3. Chapman & Hall: London, UK. ISBN 0-412-43280-3. xxvi, 794 pp.

Alvarado, J.J., F.A. Solis-Marin & C. Ahearn. (2008). Equinodermos (Echinodermata) del Caribe Centroamericano. Rev.Biol.Trop. 56 (Suppl. 3): 37-55.

Barcode of Life

Genbank

World Asteroidea Database

LSID urn:lsid:marinespecies.org:taxname:158491


Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Coppard , Simon

Source: The Echinoderms of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Synonymised taxa

Asterias aranciaca Gould, 1841 (synonym according to Perrier (1875))
Asterias articulata Say, 1825
Astropecten buschi Müller & Troschel, 1843 (A variety of A. articulatus (Say, 1825) according to Doderlein (1917))
Astropecten dubius Gray, 1840 (synonym)
Astropecten duplicatus Koehler, 1909 (synonym)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Coppard , Simon

Source: The Echinoderms of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Neotype for Asterias articulata Say, 1825
Catalog Number: USNM E12852
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Year Collected: 1966
Locality: Daytona Beach, East Of, Florida, United States, North Atlantic Ocean
Depth (m): 24 to 26
Vessel: Oregon R/V
  • Neotype: Say. 1825. J. Acad. Nat. Sci. Phila. 5(1): 141-142.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 169 specimens in 1 taxon.
Water temperature and chemistry ranges based on 83 samples.

Environmental ranges
  Depth range (m): 3 - 498
  Temperature range (°C): 11.259 - 27.707
  Nitrate (umol/L): 0.320 - 16.624
  Salinity (PPS): 34.352 - 36.715
  Oxygen (ml/l): 3.183 - 5.598
  Phosphate (umol/l): 0.069 - 1.376
  Silicate (umol/l): 0.942 - 12.088

Graphical representation

Depth range (m): 3 - 498

Temperature range (°C): 11.259 - 27.707

Nitrate (umol/L): 0.320 - 16.624

Salinity (PPS): 34.352 - 36.715

Oxygen (ml/l): 3.183 - 5.598

Phosphate (umol/l): 0.069 - 1.376

Silicate (umol/l): 0.942 - 12.088
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Astropecten articulatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ACACTTTATTTAATCTTTGGAGCCTGAGCCGGAATGGTTGGAACAGCAATGAGAGTAATAATTCGGACAGAACTAGCTCAACCTGGATCTCTTCTCCAAGAT---GACCAAATCTATAAAGTAATTGTTACAGCCCACGCCCTAGTAATGATATTCTTTATGGTGATGCCCATAATGATTGGAGGATTTGGGAATTGACTAATTCCCCTAATGATTGGAGCGCCAGATATGGCTTTTCCACGAATGAATAAAATGAGATTCTGACTAGTCCCCCCATCATTTCTTTTACTTGTAGCCTCAGCAGGCGTAGAAAGAGGTGCTGGAACAGGGTGAACAATCTACCCACCTCTGTCTAGAGGACTAGCACACGCAGGGGGCTCCGTAGATTTAGCCATCTTTTCTCTTCACTTAGCCGGTGCTTCCTCCATTCTAGCTTCAATTAATTTTATCACAACCGTAATAAAAATGCGAACACCCGGAATTTCATTCGACCGACTTCCACTTTTTGTCTGATCAGTGTTCGTTACTGCTTTTCTTCTTCTCCTTTCTCTTCCAGTATTAGCCGGAGCAATAACAATGCTCCTTACCGACCGAAACGTAAACACAACCTTCTTTGACCCCGCTGGAGGGGGAGATCCAATCCTATTTCAACACCTATTCTGATTTTTTGGCCACCCCGAAGTATACATCCTTATCCTCCCAGGATTCGGA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Astropecten articulatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Astropecten articulatus

Astropecten articulatus or royal starfish is a sea star of the family Astropectinidae.[1]

Habitat and behavior[edit]

The habitat of the Astropecten articulatus varies from 0 - 200 metres (700 ft) and it lives most commonly at the mid continental shelf around 20–30 metres (70–100 ft).[2]

Astropecten articulatus is found along the east coast and commonly along the southeast coast of the United States.[3]

Description[edit]

Astropecten articulatus has dorsal granulose paxillae that are usually dark blue to purple and orange marginal plates with supermarginal white spines.

The five ambulacral grooves contain numerous ambulacral spines and tube feet. The mouth has a set of five jaws covered with spines. The color of the madreporite is light orange, and it has raised pores that connect to the water vascular system. The arms can reach 2–9 centimetres (0.8–4 in) in length.[3]

Astropecten articulatus has large orangish yellow marginal plates. It has short paxillae that give the aboral surface a granular appearance.[4] Its paxillar areas on the arms are about twice the width of the marginals and are very compact. Fresh specimens are usually bright blue or purple with yellow, orange, or white marginals.[2]

Feeding[edit]

Astropecten articulatus is a carnivore and feeds on molluscs, which it catches with its arms and then takes to the mouth. The prey is then trapped by the long, moving prickles around the mouth cavity. Unlike other starfish, it swallows food whole.

References[edit]

  1. ^ a b C. Mah & H. Hansson (2011). "Astropecten articulatus (Say, 1825)". In C. L. Mah. World Asteroidea database. World Register of Marine Species. Retrieved 26 May 2012. 
  2. ^ a b Perry; Larsen (24 April 2004). "Astropecten articulatus (Say, 1825)". Guide to Shelf Invertebrates, Gulf of Mexico. Gulf States Marine Fisheries Commission. Retrieved 27 May 2012. 
  3. ^ a b Leslie Sautter. "Astropecten articulatus". Publication of Project Oceanica, created by Leslie Sautter as part of the College of Charleston Transects Program. College of Charleston. Retrieved 27 May 2012. 
  4. ^ Pollock, Leland W. (1 March 1998). A Practical Guide to the Marine Animals of Northeastern North America. Rutgers University Press. p. 270. ISBN 0-8135-2399-0. Retrieved 27 May 2012. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!