Ecology

Habitat

Depth range based on 2 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 60 - 62
  Temperature range (°C): 18.003 - 18.003
  Nitrate (umol/L): 0.757 - 0.757
  Salinity (PPS): 33.923 - 33.923
  Oxygen (ml/l): 5.258 - 5.258
  Phosphate (umol/l): 0.428 - 0.428
  Silicate (umol/l): 2.671 - 2.671

Graphical representation

Depth range (m): 60 - 62
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Linckia columbiae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTAATGATAGGGGCACCAGATATGGCGTTCCCACGAATGAACAAAATGAGATTTTGGCTTATTCCCCCTTCATTTCTTCTTCTCGTAGCCTCAGCTGGTGTAGAAAGTGGTGCCGGTACAGGATGAACCATTTATCCACCACTTTCTAGTGGGCTTGCCCATGCTGGGGGGTCAGTTGATCTCGCTATATTTTCACTTCATCTAGCAGGTGCATCATCCATCCTTGCATCAATAAAATTTATTACAACTGTAATAAATATGCGAACACCCGGTATTTCATTTGACCGGTTACCACTATTCGTATGATCAGTATTTGTAACAGCCTTTCTTCTCCTTCTTTCCCTTCCAGTTCTTGCTGGGGCTATAACAATGCTTTTAACCGACCGCAATGTTAATACTACCTTCTTTGACCCCGCTGGAGGTGGTGACCCAATTCTATTCCAGCACTTATTCTGATTCTTTGGTCACCCCGAAGTTTACATTCTTATACTTCCCGGTTTCGGAATGATATCTCACGTAATTGCACACTACTCTGGGAAGAGCGAACCATTTGGTTACTTGGGAATGGTTTACGCCATCGTATCTATAGGTATTCTGGGTTTCTTGGTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Linckia columbiae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Linckia columbiae

Linckia columbiae is a species of starfish in the family Ophidiasteridae that is found off the coast of California and adjacent areas of the semi-tropical north east Pacific Ocean. Common names include the fragile star, the Pacific comet sea star and the variable sea star.

Description[edit]

Linckia columbiae can grow to 10cm (4in) across and varies greatly in colour and shape and even the number of rays. Writing in 1904, Monks stated,

"In over 400 specimens examined not more than four were symmetrical, and no two were alike ... The normal number of rays is five, but some specimens have only one, while others have four, six, seven or even nine."[2]

The disc is small with one or two madreporites, usually oval and variable in size. The long cylindrical rays have blunt, triangular points that turn up slightly at the tip. The surface is covered in hemispherical granules which are larger near the ambulacral grooves. There are two rows of ambulacral plates which distinguishes this species from the very similar Linckia guildingi which has three rows. The colour is generally mottled grey and red and there are a number of rows of tiny yellow stars running longitudinally down each ray.[3]

Distribution and habitat[edit]

Linckia columbiae is found off the Pacific coast of California as far north as San Diego and San Pedro, and also in Columbia and the Galapagos Islands.[2] It is found on rocks in the intertidal zone at depths down to about 150m (500ft).[4]

Biology[edit]

This species often undergoes autotomy, a process where one or more rays becomes detached. The animal remains stationary while the ray, using its tube feet for purchase, pulls and twists itself away from the disc until the tissue connecting the two breaks. The separated ray is known as a "comet" and a new disc and a number of new rays start to grow on the damaged surface, a process that takes about six months to complete.[2]

References[edit]

  1. ^ a b Linckia columbiae - Gray, 1840 World Register of Marine Species. Retrieved 2011-10-02.
  2. ^ a b c Ricketts, Edward Flanders; Jack Calvin and Joel Walker Hedgpeth. Between Pacific Tides: Fifth Edition. Google Books. pp. 96–7. Retrieved 2011-10-02. 
  3. ^ ESTUDIO MORFOLÓGICO, TAXONÓMICO, ECOLÓGICO Y DISTRIBUCIÓN GEOGRÁFICA DE LOS ASTEROIDEOS COLECTADOS DURANTE LAS CAMPAÑAS OCEANOGRÁFICAS CORTÉS 1, 2, 3 Retrieved 2011-10-02.
  4. ^ Linckia columbiae Charles Darwin Foundation: Galapagos Species Checklist. Retrieved 2011-10-02.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!