Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

The common sunstar is named after the fact that it looks like a sun with its 8 to 14 arms. Its colorful, sunny appearance makes you think it has a nice character, but nothing is farther from the truth. It is a fearsome predator, which scares the daylights out of common starfish and other smaller marine animals. The common sunstar is quite fast for a starfish, reaching top speeds of 70 centimeters per minute. There are films where you see how brittle stars and sea urchins run away as soon as a sunstar is in the vicinity. If they are not fast enough, they are inevitably consumed.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description

 A very distinctive sun star that grows up to 34 cm in diameter. The colour varies but is usually red, brown-red with white markings above, yellow-white below, often with beautiful patterns. It has 10-12 arms (rarely 8-16) and the whole surface of the animal is covered with small but distinct spines.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology/Natural History: Diet includes sea pens, nudibranchs such as Archidoris odhneri and Coryphella sp, the scallops Chlamys hastata and C. rubida, bryozoans, and tunicates. Has been known to attack the seastar Evasterias troschelii and Leptasterias sp. Predators include the seastars Solaster dawsoni and Pycnopodia helianthoides. May have the symbiotic polychaete worm Arctonoe vittata. This species can move relatively fast for a seastar--up to 70 cm/minute. Spawns March to April. Juveniles often cluster subtidally in masses of the tubedwelling polychaete Phyllochaetopterus prolifica. Grow slowly--maximum size is achieved after about 10 years.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This many-rayed seastar has a broad central disk and 8-16 rays, has abundant scattered spines (paxillae) on the aboral surface (photo) but no pedicellariae. Its color is a rose-red with light pink or white (picture) (sometines yellow or orange). Up to 30 cm diameter.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

A starfish with many arms, usually 13 but occasionally from 8-14. Colour is variable from dirty brown through dirty purple to a beautiful red form with concentric rings of white. The texture is very spiny with large groups of bristly spines over the dorsal surface. Typically 25cm up to 35cm diameter. The only other sunstar to be found in shallow water is Solaster endeca.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

North Atlantic and Pacific Coasts: (Himmelman and Dutil, 1991) One can find C. papposus from Alaska to Puget Sound, from the Artic to the Gulf of Maine. (MConnaughey and McConnaighey, 1985) It is common in British waters and in eastern Maine and can often be found in the lower intertidal zone from the Eastport area northward. (Hayward and Ryland, 1995)

Biogeographic Regions: atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

From low intertidal to more than 200 m depth, mainly on coarse sand and gravel, all round the British Isles
  • Southward, E.C.; Campbell, A.C. (2006). [Echinoderms: keys and notes for the identification of British species]. Synopses of the British fauna (new series), 56. Field Studies Council: Shrewsbury, UK. ISBN 1-85153-269-2. 272 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Arctic to Gulf of Maine
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographical Range: Bering Sea to Puget Sound; Arctic Ocean, North Atlantic Ocean, North Sea, western Baltic sea (circumpolar)

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common and widespread all round the British Isles but rare on the south coast.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Crossaster papposus ranges from 8" to 14" in diameter. It has many arms (between 8 and 14) the length of one-half its radius. It is scarlet on top with concentric bands of white, pink, yellow, or dark red, and it is white on the underside. Its entire upper surface is sparsely covered with brushlike bristles. (McConnaughey and McConnaughey, 1985) These bristles, called pseudopaxillae, consist of bundles of fine spines atop short stumps. The mouth area is bare, and it has two rows of sucker-tipped sensory tube feet. (Gosner, 1978)

Other Physical Features: ectothermic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

How to Distinguish from Similar Species: Solaster stimpsoni and S. dawsoni have much smaller central disks in relation to their total diameter and do not have the abundant aboral spines nor this coloration. Pycnopodia helianthoides has more rays (when mature), grows larger, and has abundant pedicellariae, plus its rays are very flabby.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Crossaster papposus is found on rock bottoms, ranging from the low tide line to approximately 1080' (329m) deep. (McConnaughey and McConnaughey, 1985) It is tolerant of strong sunlight. (Coleman, 1991)

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

bathyal, infralittoral and circalittoral of the Gulf and estuary
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1230 specimens in 1 taxon.
Water temperature and chemistry ranges based on 552 samples.

Environmental ranges
  Depth range (m): 0 - 45627
  Temperature range (°C): -1.770 - 11.851
  Nitrate (umol/L): 0.504 - 44.769
  Salinity (PPS): 27.165 - 35.352
  Oxygen (ml/l): 0.545 - 8.971
  Phosphate (umol/l): 0.091 - 3.312
  Silicate (umol/l): 1.791 - 175.486

Graphical representation

Depth range (m): 0 - 45627

Temperature range (°C): -1.770 - 11.851

Nitrate (umol/L): 0.504 - 44.769

Salinity (PPS): 27.165 - 35.352

Oxygen (ml/l): 0.545 - 8.971

Phosphate (umol/l): 0.091 - 3.312

Silicate (umol/l): 1.791 - 175.486
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 Found on sand, stones, mussel and oyster beds from the infralittoral fringe to 50 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth Range: Extremely low intertidal to 1200 m. Mostly subtidal.

Habitat: Varied.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Found in sheltered sites with moderate tidal streams and semi-exposed rocky or bouldery sites. Frequent in brittle-star beds.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

In its habitat, C. papposus is considered to be the dominant predator, along with Solaster endece, another species of predacious sea star. As a dominant predator, C. papposus plays an important role in determining community structure. (Himmelman and Dutil, 1991) Its abundance and frequent predatory activity suggests that it belongs to an important predatory guild. C. papposus has often been observed feeding on urchins, as well as on numerous other invertebrates, including echinoderms, bivalves, cnidarians, and tunicates. (Coleman, 1991) Cannibalism in C. papposus is rare, observed only after long starvation in captivity. (Sloan, 1984)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Breeding

Direct development? Winter
  • Southward, E.C.; Campbell, A.C. (2006). [Echinoderms: keys and notes for the identification of British species]. Synopses of the British fauna (new series), 56. Field Studies Council: Shrewsbury, UK. ISBN 1-85153-269-2. 272 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Crossaster papposus, like most sea stars, has separate sexes, and fertilization is external. (Hickman and Roberts, 1995) Sexual reproduction produces lecithotropic larva in late winter. One-year-old individuals measure 1.8 to 4.0 cm in diameter, and there is a 2 cm annual growth increment during the following few years. (Himmelman and Dutil, 1991) Juvenile C. papposus tend to prefer sediment bottoms of the sea. Upon growing to 5cm in diameter, C. papposus migrates to shallow water (4-8cm in diameter) and then, with increasing size, it gradually moves to greater depths. (Himmelman and Dutil, 1991) Like other sea stars, C. papposus can regenerate injured or missing arms, as long as a portion of the central disc, where the arms converge, is intact. (Hickman and Roberts, 1995)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Crossaster papposus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 20 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AGACGATGACTATTTTCTACTAAACACAAGGATATTGGGACTCTATATTTAATATTTGGTGCATGAGCCGGAATGACCGGAACAGCAATGAGAGTAATTATACGAACAGAACTCGCACAACCAGGATCACTCCTTCAAGAC---GACCAAATATATAAAGTANTTGTAACCGCGCATGCTCTAGTAATGATATTTTTTATGGTGATGCCCATAATGATAGGAGGATTTGGAAAATGACTTATACCTTTAATGATAGGTGCCCCAGATATGGCCTTCCCTCGAATGAATAAAATGAGATTTTGACTAATCCCCCCCTCTTTTATTCTACTTTTAGCATCTGCAGGGGTAGAAAGAGGAGCCGGAACAGGGTGAACTATGTATCCTCCACTTTCTAGAGGTTTAGCCCACGCTGGGGGATCAGTTGACTTAGCAATATTTTCCTTCAACTTAGCAGGAGCTTCTTCTATTTTAGCTTCTATAAAATTTATAACAACAGTAATAAAAATGCGAACACCAGGAATTACATTTGACCGATTACCTTTATTTGTATGATCAGTATTTGTAACAGCATTCCTTCTTCTTTTATCCTTACCAGTTCTAGCAGGAGCTATAACCATGTTACTTACAGATCGAAAAATAAACACAACATTTTTTGACCCAGCAGGGGGTGGAGATCCTATACTATTCCAACACTTATTCTGATTTTTTGGTCACCCTGAAGTTTATATTCTTATCCTTCCAGGATTTGGTATGATTTCTCATGTCATAGCTCACTATTCAGGAAAGAAAGAACCCTTTGGATATTTAGGAATGGTTTATGCTATAATTTCTATTGGTATTCTTGGATTTTTAGTTTGAGCTCACCATATGTTTACAGTAGGAATGGACGTAGATACTCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Crossaster papposus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 22
Specimens with Barcodes: 28
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Unfortunately, information regarding the economic importance of C. papposus and its value to humans is either not well-studied, not well-documented, or simply inaccessible. As an aggressive predator high on its food web and as an agent of dispersal of both its competitors and prey, C. papposus clearly has a significant impact on its ecosystem.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Rose sea star

The rose sea star (Crossaster papposus) is a species of sea star of the family Solasteridae. Latin pappus, bristles, teeth, referring to the spiny surface. The rose star typically has a bulls eye pattern and can very greatly in color from solid magenta, bright pink, red, orange or yellow. Usually C. papposus has 8 to 16 rays. Diet includes sea pens, nudibranchs, bryozoa, sea squirts and bivalves and can live for at least 20 years. Crossaster papposus can be found in the Pacific, to Washington and the Sea of Okhotsk; in the Atlantic to 40°N latitude on the American side, and to Scandinavia and the British Isles on the northern European coast. Found from the intertidal zone to 1200 meters deep on soft mud, gravel, sand, pebbles or rock.

References[edit]

  • Sea Stars Of British Columbia, Southeast Alaska and Puget Sound. Philip Lambert. 2000


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Common sunstar

The common sunstar or Crossaster papposus is a species of sea star belonging to the family Solasteridae.[1] It is found in the northern parts of both the Atlantic and the Pacific Oceans.

Distribution[edit]

The common sunstar is distributed from the Arctic down to the English Channel, in the North Sea, also on both East (from the Arctic to the Gulf of Maine) and Pacific coasts (from Alaska to Puget Sound) of North America. It is also circumboreal, found in Greenland, Iceland, the Barents Sea, Kola Bay, Okhotsk Sea and the White Sea. It has also been observed in the Sargasso Sea and Sea of Japan.

Habitat[edit]

The common sunstar is commonly found on rocky bottoms, coarse sand and gravel in the bathyal, infralittoral and circalittoral zone (from low-tide line up to depths of 300 m). It seems to prefer areas of high water movement. Very small sunstars are sometimes found in rock pools.[2]

Description[edit]

It is reddish on top with concentric bands of white, pink, yellow, or dark red, and it is white on the underside. It is covered on top with brushlike spines, with the marginal spines somewhat larger. The thick, central disc is fairly large. This central disc has a netlike pattern of raised ridges. The mouth area is bare. It has relatively short arms which usually number eight to fourteen. Its radius can be up to 15cm. The madreporite plate stands out clearly.

Food[edit]

The common sunstar is an omnivore. It will eat almost anything including smaller starfish and sunstars, swallowing them whole. It is also a scavenger.

References[edit]

  • World Register of Marine Species : Mah, C.; Hansson, H. (2009). Crossaster papposus (Linnaeus, 1776). In: Mah, C.L. (2009). World Asteroidea database. Accessed through: World Register of Marine Species at on 2010-06-12
  • Hansson, H.G. (2001). Echinodermata, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 336-351
  • Clark, A.M. and M.E. Downey. (1992). Starfishes of the Atlantic. Chapman & Hall Identification Guides, 3. Chapman & Hall: London, UK. ISBN 0-412-43280-3
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!