Overview

Comprehensive Description

Description

 Solaster endeca is a fairly large species up to 40 cm in diameter, although usually observed at approximately 20 cm. This species has 9-10 tapering arms (occasionally 7-13) set around a large disc. Its dorsal surface is supported by closely packed skeletal plates, which posess close-set, short paxillae that further bear spinelets (small, movable projections). It also bears two rows of marginal paxillae with the upper smaller than the lower. It is variable in colouration: dirty cream, orangey-red to bright pink-purple dorsally with a pale orange underside. The tips of the arms are commonly turned upwards to reveal the underside and two rows of tube feet (podium) with sucking discs. The adambulacral plates (series of calcareous plates flanking the ambulacral furrow), with a series of 2-3 spines (ambulacral furrow spines) also bear rows of 6-8 shorter spines.Solaster endeca breeds during March-April with direct development and, therefore, has no pelagic stage. It is a voracious predator on other Echinoderm species often eating animals nearly as large as itself (Gibson et al., 2001). It is the only British starfish with as many arms as Crossaster papposus (Picton, 1993), however, Solaster endeca has a much smoother appearance.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

A starfish with nine or ten arms. The dorsal surface is rough, with a close-set armament of clusters of fine spinelets. Colour varies from a dirty cream colour to a beautiful pink-purple. The tips of the arms are often turned up and pale coloured. Up to 40cm diameter, commonly 20cm. The only British starfish with as many arms is Crossaster papposus. The colour and texture is similar to some specimens of Henricia oculata but this species has only five (occasionally six) arms.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

In 5 or more than 200 m on various substrates. Northwest coasts, occasional in western Ireland, Irish Sea and Shetland, and south along the northeast coast as far south as Northumberland
  • Southward, E.C.; Campbell, A.C. (2006). [Echinoderms: keys and notes for the identification of British species]. Synopses of the British fauna (new series), 56. Field Studies Council: Shrewsbury, UK. ISBN 1-85153-269-2. 272 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Arctic to Cape Cod
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Recorded from the south coast of Ireland north around the British Isles to the North Sea. Apparently absent from the south coast of England and much commoner in Scotland.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

infralittoral and circalittoral of the Gulf and estuary
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 272 specimens in 1 taxon.
Water temperature and chemistry ranges based on 157 samples.

Environmental ranges
  Depth range (m): 0 - 2811
  Temperature range (°C): -1.107 - 9.911
  Nitrate (umol/L): 1.051 - 44.988
  Salinity (PPS): 27.109 - 35.221
  Oxygen (ml/l): 0.428 - 8.585
  Phosphate (umol/l): 0.090 - 3.427
  Silicate (umol/l): 1.867 - 173.766

Graphical representation

Depth range (m): 0 - 2811

Temperature range (°C): -1.107 - 9.911

Nitrate (umol/L): 1.051 - 44.988

Salinity (PPS): 27.109 - 35.221

Oxygen (ml/l): 0.428 - 8.585

Phosphate (umol/l): 0.090 - 3.427

Silicate (umol/l): 1.867 - 173.766
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 This species can be found on muddy gravel or silty rocks in sheltered or moderately exposed conditions, from the infralittoral fringe to 500 m depth.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Normally found on muddy gravel with boulders, or on silty rock surfaces in sheltered or semi-exposed conditions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Breeding

Direct development. March-April
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Solaster endeca

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Solaster endeca

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GACTCTTTATCTAATATTCGGTGCATGAGCAGGAATGACCGGAACAGCAATGAGGGTAATAATACGAACAGAACTCGCACAACCAGGATCACTCCTTCAAGATGACCAGATATATAAAGTAATTGTAACAGCTCACGCTCTAGTTATGATATTTTTTATGGTAATGCCCATAATGATAGGCGGATTTGGAAAATGACTTATACCTTTAATGATAGGTGCCCCTGATATGGCCTTCCCTCGAATGAATAAAATGAGATTTTGACTAATTCCCCCTTCTTTTATTTTACTTTTAGCATCTGCCGGAGTAGAAAGAGGAGCTGGAACAGGATGAACTATATACCCCCCACTTTCTAGAGGATTAGCACACGCTGGGGGATCAGTTGACTTAGCAATATTTTCCCTTCATTTAGCGGGAGCCTCTTCTATTTTAGCATCCATAAAATTTATAACTACAGTAATAAAAATGCGTACACCAGGCATTACATTTGACCGGCTACCCCTATTCGTATGATCAGTATTTGTTACTGCATTTCTTCTTCTCTTATCCCTACCAGTACTAGCTGGGGCCATAACCATGTTACTCACAGATCGAAAAATAAACACAACATTCTTTGACCCAGCAGGCGGAGGGGATCCAATATTATTCCAACACCTATTCTGATTTTTTGGCCACCCCGAAGTATACATTTTAATACTTCCAGGATTTGGTATGATTTCTCATGTTATTGCCCACTACTCTGGAAAGAAAGAACCTTTTGGATATCTAGGAATGGTTTACGCTATAATCTCTATTGGCATTCTTGGATTTTTAGTCTGAGCTCACCATATGTTCACAGTTGGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Solaster endeca

The purple sunstar, northern sunstar, or smooth sun star, Solaster endeca, is a species of starfish in the family Solasteridae.[1]

Description[edit]

Solaster endeca can grow to about 40 cm (16 in) across, but 20 cm (7.9 in) a more normal adult size is half that. It is a robust species with 9 or 10 arms (occasionally any number from seven to 13) set around a large disc. The aboral (upper) surface is formed of calcareous plates densely covered with paxillae, peg-like projections covered in tiny spinelets. No pedicellariae are present, but groups of two to three gills are found between the plates. On the oral (under) surface, the row of plates on either side of the ambulacral groove bear two or three spines and several rows of shorter spines, with two rows of tube feet. S. endeca ranges in colour from greyish-cream to pinkish-purple. The arms are often turned up at the tips, showing the pale oral surface.[2] It can be confused with Crossaster papposus , the only British species with a similar number of arms, but S. endeca has a smoother aboral surface.[3][4][5]

Distribution and habitat[edit]

The purple sun star occurs in the northeastern Atlantic Ocean and the North Sea at depths to 450 m (1,480 ft). Its typical habitats are muddy sand, gravel, or rocky areas with deposited sediment. It is found in both sheltered and fairly exposed locations.[4] It also has a circumboreal distribution and is found round the coasts of Greenland, northeastern Canada, and the East Coast of the United States as far south as the Gulf of Maine.[1] It also occurs in the northeastern Pacific Ocean between northern Alaska and Puget Sound.[6]

Biology[edit]

S. endeca is a predator. In the Atlantic Ocean, it feeds on other starfish and bivalve molluscs, but in the Pacific, its diet is mainly sea cucumbers and other invertebrates.[6]

In Britain, breeding takes place in the spring. Over a period of about a week, the female lays several thousand eggs in batches. These rise to the surface of the water where they are fertilised by sperm liberated by the male. The developing larvae become less buoyant after three days, feed on the yolks of their eggs, swim with cilia, and develop a pair of larval arms. After about 18 days, they sink to the sea bed, where each one attaches itself to the substrate with a sucker.[5] Here it undergoes metamorphosis during which it develops a disc and first five and then more arms, a pair of tube feet, relatively long spines, red eyespots on the tips of the arms, a mouth, and an anus.[5] After six weeks, the sucker is resorbed and the juvenile starfish begins to move about with its tube feet.[5]

References[edit]

  1. ^ a b c "WoRMS - World Register of Marine Species - Solaster endeca (Linnaeus, 1771)". Marinespecies.org. Retrieved 2012-02-15. 
  2. ^ Picton, B.E.; Morrow, C.C. (2010). "Solaster endeca (Linnaeus, 1771)". Encyclopedia of Marine Life of Britain and Ireland. Retrieved 2012-10-24. 
  3. ^ Sonia Rowley (2007). "Purple sun star - Solaster endeca". Marine Biological Association of the United Kingdom. Retrieved 2012-10-24. 
  4. ^ a b "Purple Sunstar (Solaster endeca)". Macrobenthos of the North Sea - Echinodermata. Marine Species Identification Portal. Retrieved 2012-10-24. 
  5. ^ a b c d Gemmill, James F (1910). "The development of the starfish Solaster endeca Forbes (1912)". Transactions of the Zoological Society of London. 
  6. ^ a b "Northern sun star". Sea stars of the Pacific Northwest. Retrieved 2012-10-24. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!