Overview

Comprehensive Description

Biology/Natural History: Solaster dawsoni is a predator on other seastars, including Solaster stimpsoni, other Solaster dawsoni, Leptasterias hexactis, Evasterias troschelii, Dermasterias imbricata, Henricia leviuscula, Crossaster papposus,Pycnopodia helianthoides, and Mediaster aequalis. It also has been seen to feed on the sea cucumbers Eupentacta quinquesemita, Psolus chitonoides, Cucumaria miniata, and young Parastichopus californicus, and on the nudibranch Tritonia festiva, which swims away rapidly when touched. Many other seastars also move away quickly when touched by S. dawsoni. S. dawsoni moves along with its leading rays raised, and lunges forward (at least fast for a seastar) when it touches another star. S. stimpsoni, one of its favorite prey species, curls all its arms upward above the disk when encountered and sometimes wards off the attack. In Auke Bay, Alaska, S. dawsoni seems to eat mainly green urchins Strongylocentrotus droebachiensis. The commensal polychaete scaleworms Arctonoe vittata and Arctonoe fragilis are common on the star. Spawning occurs in mid April in southern British Columbia. Eggs are about 1 mm in diameter. Juveniles often take refuge among the tubedwelling polychaete Phyllochaetopterus prolifica.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This large seastar has 8-16 rays (usually 11-12) and no pedicellariae. Paxillae on the aboral surface are separated from each other by about their diameter and blunt (photo), so that the dorsal surface is rather smooth. The ambulacral grooves have enlarged marginal plates along their margins. Disk diameter is about 1/3 total diameter and the aboral surface does not have a prominent gray-blue streak radiating from the central disk and out each ray (but see photo below). Rays taper gradually from base to tip. Aboral surface usually brown or or grayish, but may be orange or mottled. Diameter to 40 cm.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Geographical Range: Point Franklin, Alaska to Monterey Bay, CA (uncommon in central California)

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Look Alikes

How to Distinguish from Similar Species: Pycnopodia helianthoides grows larger, has more rays, has pedicellariae, and has obvious ossicles projecting from the aboral surface. Solaster stimpsoni has an orange or pink aboral surface with a grayish-blue streak radiating from the central disk out along each ray.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 47 specimens in 1 taxon.
Water temperature and chemistry ranges based on 21 samples.

Environmental ranges
  Depth range (m): 0 - 291
  Temperature range (°C): 0.532 - 10.345
  Nitrate (umol/L): 5.539 - 33.012
  Salinity (PPS): 31.893 - 33.674
  Oxygen (ml/l): 3.031 - 8.635
  Phosphate (umol/l): 0.684 - 2.772
  Silicate (umol/l): 12.975 - 74.514

Graphical representation

Depth range (m): 0 - 291

Temperature range (°C): 0.532 - 10.345

Nitrate (umol/L): 5.539 - 33.012

Salinity (PPS): 31.893 - 33.674

Oxygen (ml/l): 3.031 - 8.635

Phosphate (umol/l): 0.684 - 2.772

Silicate (umol/l): 12.975 - 74.514
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth Range: Intertidal to 414 m (mostly subtidal)

Habitat: Usually on rocky bottoms, but sometimes on gravel or sand

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Solaster dawsoni

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTCTATATTTAATATTTGGTGCGTGGGCTGGAATGACCGGAACAGCAATGAGAGTAATAATACGGACAGAACTTGCACAACCAGGATCACTCCTCCAAGACGACCAAATATATAAAGTAATTGTAACAGCTCATGCCCTAGTAATGATATTTTTTATGGTAATGCCCATTATGATAGGTGGATTTGGAAAATGACTTATCCCCTTAATGATAGGCGCCCCCGATATGGCCTTCCCACGAATGAATAAAATGAGATTTTGATTAATCCCTCCTTCTTTTATTCTACTTTTAGCATCTGCTGGAGTAGAAAGAGGCGCTGGAACAGGATGAACAATATACCCCCCACTTTCTAGAGGATTAGCACACGCTGGAGGATCAGTCGACTTAGCAATATTTTCTCTTCATTTAGCAGGAGCCTCCTCTATCTTAGCTTCTATAAAATTTATAACTACAGTTATAAAAATGCGCACACCAGGAATTACATTTGACCGACTTCCCTTGTTTGTATGATCAGTATTTGTTACTGCATTTCTTCTTCTTCTGTCTCTTCCAGTATTAGCTGGAGCCATAACTATGTTATTAACAGATCGTAAAATAAATACAACATTTTTTGACCCAGCAGGAGGTGGGGATCCTATATTATTCCAACACTTATTCTGATTTTTTGGCCACCCAGAAGTATATATTTTAATACTCCCAGGATTTGGTATGATTTCTCATGTTATAGCCCATTATTCAGGAAAGAAAGAACCCTTTGGATACTTAGGTATGGTTTACGCTATAATCTCTATTGGTATACTTGGGTTTTTAGTCTGAGCTCACCATATGTTTACAGTTGGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Solaster dawsoni

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Morning sun star

The morning sun star, Solaster dawsoni, is a species of starfish in the family Solasteridae. It is found on either side of the northern Pacific Ocean. It has two subspecies:

  • S. d. arcticus Verrill, 1914
  • S. d. dawsoni Verrill, 1880

Description[edit]

The morning sun star has a wide disc and eight to 16 (usually 11 or 12) long, tapering arms, often with turned-up tips. The upper or aboral surface is smooth, and its colour is usually red, orange, grey, or pale brown, sometimes with paler patches.[2][3]

Distribution[edit]

The morning sun star occurs in the northern Pacific Ocean at depths to about 420 m (1,380 ft). Its range extends from Japan, China, and Siberia to the coasts of North America as far south as California.[2] It is often found in rocky habitats, but can also inhabit other types of seabed.[3]

Behaviour[edit]

The morning sun star is a predator, feeding mostly on other starfish. It is feared by other stars which move away as fast as they can if touched by a morning sun star. In British Columbia, about half of its diet consists of leather stars (Dermasterias imbricata), which move too slowly to evade it. Other sea stars such as the velcro star (Stylasterias forreri) and the rainbow star (Orthasterias koehleri) fight back at their attacker. They have numerous tiny pincer-like organs called pedicellariae and coil their arms around the morning sun star, nipping it with these. It recoils and its prey often manages to escape. Another sometimes successful defence strategy is used by the slime star (Pteraster tesselatus) which inflates its aboral surface making it difficult for the attacker to get a grip on it and at the same time exudes copious amounts of noxious mucus.[2] Even the often larger sunflower seastar (Pycnopodia helianthoides) retreats when touched by a morning sun star.[2] If grabbed, the sunflower star may leave one of its arms behind, a process called autotomy, sacrificing this limb to make its escape.[4] The morning sun is also a cannibal, feeding on other individuals of its own species, and also feeds on sea cucumbers and diamondback nudibranchs.[3]

The morning sun star breeds between March and June. The gonads release eggs and sperm which rise to the surface where the eggs are fertilised. They have large yolks and the developing larvae rely on this and do not feed. They can swim and they drift with the currents as part of the zooplankton. They later sink to the seabed and undergo metamorphosis into juvenile starfish.[3][5]

References[edit]

  1. ^ "WoRMS - World Register of Marine Species - Solaster dawsoni Verrill, 1880". Marinespecies.org. Retrieved 2012-02-15. 
  2. ^ a b c d "Morning sun star: Solaster dawsoni". Sea stars of the Pacific Northwest. 2011. Retrieved 2012-09-21. 
  3. ^ a b c d "Solaster dawsoni". Race Rocks Taxonomy. Retrieved 2012-09-21. 
  4. ^ "Sunflower star: Pycnopodia helianthoides". Sea stars of the Pacific Northwest. 2011. Retrieved 2012-09-24. 
  5. ^ Dorit, R. L.; Walker, W. F.; Barnes, R. D. (1991). Zoology. Saunders College Publishing. p. 782. ISBN 0-03-030504-7. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!