Overview

Comprehensive Description

Biology/Natural History: Feeds on small sea cucumbers, including Eupentacta quinquesemita, E. pseudoquinquesemita, Cucumaria miniata, C. curata, and Psolus chitonoides. May also eat tunicates such as Pyura haustor, brachiopods, and sea pens. Another common sun star, Solaster dawsoni, is an important predator of this species. May have a commensal polychaete scaleworm Arctonoe pulchra or Arctonie vittata in the ambulacral groove. A parasitic barnacle Dendrogaster sp may be inside the tissues. Eggs are 0.9 to 1 mm diameter, yellow. Juveniles often hide among tubedwelling polychaete Phyllochaetopterus prolifica.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This large mostly subtidal seastar has 9-12 (usually 10) rays and no pedicellariae. The paxillae on the aboral surface are crowded together giving a rather smooth grainy texture. The disk is about 1/4 the total diameter. Aboral surface usually red, pink, or orange with a gray or blue streak down the center of each ray from a patch from the central disk. Up to 50 cm diameter
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Geographical Range: Bering Sea to Salt Point, Sonoma County, CA (not common in California); Japan

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Look Alikes

How to Distinguish from Similar Species: Other sun stars have a central disk about 1/3 the total diameter and no prominent dark streaks on the aboral surface. The other most common sun star, S. dawsoni, has an orange, brown, tan, or mottled aboral surface.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 51 specimens in 1 taxon.
Water temperature and chemistry ranges based on 41 samples.

Environmental ranges
  Depth range (m): 0 - 731.52
  Temperature range (°C): 3.792 - 10.151
  Nitrate (umol/L): 6.725 - 21.606
  Salinity (PPS): 31.692 - 33.129
  Oxygen (ml/l): 5.231 - 6.616
  Phosphate (umol/l): 0.943 - 2.341
  Silicate (umol/l): 15.658 - 56.451

Graphical representation

Depth range (m): 0 - 731.52

Temperature range (°C): 3.792 - 10.151

Nitrate (umol/L): 6.725 - 21.606

Salinity (PPS): 31.692 - 33.129

Oxygen (ml/l): 5.231 - 6.616

Phosphate (umol/l): 0.943 - 2.341

Silicate (umol/l): 15.658 - 56.451
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth Range: Extreme low intertidal to 610 m

Habitat: Mostly rocky subtidal; occasionally on floats and pilings.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Solaster stimpsoni

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AGACGATGACTATTTTCAACTAAACACAAGGATATTGGAACACTATATCTAATATTTGGTGCATGGGCTGGAATGGCCGGAACAGCAATGAGAGTAATAATACGAACAGAACTTGCACAACCAGGATCNCTCCTCCAAGAT---GACCAAATATATAAAGTAATTGTAACAGCTCATGCCTTANTGATGATATTTTTTATGGTTATGCCCATAATGATTGGAGGGTTCGGAAAATGACTTATTCCTTTAATGATAGGCGCCCCANACATGGCCTTCCCNCGAATGAATAAAATGAGATTTTGATTAATACCTCCTTCCTTTATTCTACTTTTAGCATCCGCTGGAGTAGAAAGAGGTGCTGGAACAGGGTGACCATATACCCCCCACNTTTNTAGAGGATTGGCACACGCCGGAGGATCTGTTGACTTAGCAATCTTTTCCCTCCANTTAGCAGGAGCTTCATCTATCTTAGCCTCTATAAAATTTATAACTACGGTTATAAAAATGCGCACACCTGGGATTACATTTGACCGATTACCCTTATTTGTATGATCAGTATTTGTCACCGCATTTCTTCTTCTCTTATCGCTACCAGTCCTAGCTGGGGCCATAANTATGTTACTTACAGACCGAAAAATAAACACAACATTCTTTGACCCTGCAGGCGGAGGGGATCCTATATTATTTCAACATCTATTCTGATTTTTTGGTCACCCTGAAGTTTATATTCTAATACTTCCTGGTTTTGGCATGATCTCTCACGTTATTGCCCACTACTCAGGAAAGAAAGAACCTTTTGGGTACCTACGAATGGTTTATGCTATAATCTCTATTGGTATTCTTGGATTTTTAGTTTGGGCTCACCACATGTTTACAGTAGGAATGGACGTAGATACTCGGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Solaster stimpsoni

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Solaster stimpsoni

Solaster stimpsoni, common names Stimpson's sun star, sun star, orange sun star, striped sunstar, and sun sea star, is a species of starfish in the family Solasteridae.[1][2][3][4][5][6]

Description[edit]

Solaster stimpsoni 001.jpg

Solaster stimpsoni is a large species, growing up to 50 cm in diameter. It can have 8 to 12 arms, but usually has 10.[2] The aboral surface has a distinctive reddish orange colour and is covered with thick paxillae. The arms are long, slender, and tapering, each with a dark, purplish-grey contrasting stripe, running from the centre of the body to the tip.[5] They contain no pedicellariae. The underside of the arms have two rows of tube feet.

Distribution[edit]

This species is found in the seas of Japan, and along the western coast of the United States, from central California, to as far north as Alaska.[4]

Habitat[edit]

Solaster stimpsoni usually lives on rocky surfaces in the subtidal, and occasionally the low intertidal zones, at depths from 0 to 610 metres.

Diet[edit]

This starfish feeds on various small sea cucumbers, such as Cucumaria miniata, Cucumaria curata, Eupentacta quinquesemita, Eupentacta pseudoquinquesemita, and Psolus chitonoides. It also eats brachiopods, ascidians, or sea pens.

Predators[edit]

Solaster stimpsoni is eaten by Solaster dawsoni, the morning sunstar.[3]

References[edit]

  1. ^ "WoRMS - World Register of Marine Species - Solaster stimpsoni Verrill, 1880". Marinespecies.org. 2008-01-24. Retrieved 2012-02-13. 
  2. ^ a b Dave Cowles. "Solaster stimpsoni". Wallawalla.edu. Retrieved 2012-02-13. 
  3. ^ a b Joan Gerteis. "Solaster stimpsoni". Beachwatchers.wsu.edu. Retrieved 2012-02-13. 
  4. ^ a b "AFSC/RACE - Sun Sea Star, Solaster stimpsoni". Afsc.noaa.gov. 2006-12-06. Retrieved 2012-02-13. 
  5. ^ a b "Solaster stimpsoni | Marine Biodiversity of British Columbia". Bcbiodiversity.lifedesks.org. Retrieved 2012-02-13. 
  6. ^ "The World Asteroidea Database - Solaster stimpsoni Verrill, 1880". Marinespecies.org. 2008-01-24. Retrieved 2012-02-13. 


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!