Overview

Comprehensive Description

Biology/Natural History: Diet includes sponges such as Halochondria panicea, Aplidium, Didemnum, and Corella inflata tunicates, and bivalves such as the falsejingle Pododesmus macroschisma. Ambulacral grooves may have the symbiotic polychaete worm Arctonoe pulchra, A. vittata, or Ophiodromus pugettensis.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This 5-rayed seastar has a thick, broad central disk and rays approximately as long as the central disk is wide. It has no conspicuous marginal plates; in fact, the entire aboral surface is covered with a thick, loose, elevated fleshy membrane, giving it a fairly smooth texture and soft feel. The madreporite cannot be seen--instead, a central pore opens into the spongy space between the membrane and the aboral surface. When disturbed, often secretes large amounts of a thick, viscous slime. Color yellowish brown or pale orange. Diameter about 15 cm.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Geographic Range

Occupies the Bering Sea south along the North American coast to Washington, also in the Uyak Bay and around Kodiak Island and Alaska (Chia, 1966; Zintheo, 1946).

Biogeographic Regions: pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographical Range: Bering Sea to Carmel Bay, CA

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Pteraster tesselatus is commonly called the cushion star because of its inflated appearance. The disc is high, averaging 35mm in height, and the rays, usually five, are short and thick, causing the cushion star to appear pentagonal in shape. The outer membrane is thick and spongy and has regular reticulation 5 to 8mm across. The surface of the membrane varies greatly in texture from smooth to slimy and rough. On the rays, combs are composed of 5 to 7 spines arranged in a fan-shaped manner. In between the rows of combs lie two rows of large tube feet ending in sucking devices. The last ten pairs of tube feet of each ray have no sucking devices and appear to be tactile. At the end of each ray, there is a red eye spot protected by short spines. A large oral opening at the center of the disc is surrounded by a sphincter-like membrane. The colors of the cushion star include cream, tan, yellow, orange, and a gray purple (Zintheo,1946).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

How to Distinguish from Similar Species: No other common local species secretes the copious slime nor has the elevated membrane over the aboral surface. Dermasterias imbricata is not as thick, the madreporite can be seen, and is usually reddish brown with gray or purple. Asterina miniata and Mediaster aequalis have obvious plates (ossicles) on the aboral surface.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

The cushion star is found mainly in channels or other places with strong currents. Depths at which the P. tesselatus are found at ranges from 20 to 250 meters but the most abundant populations are at 45 meters. The surrounding elements that are found with the cushion star are mostly scallops, sponges, and shells (Zintheo, 1946).

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 38 specimens in 2 taxa.
Water temperature and chemistry ranges based on 17 samples.

Environmental ranges
  Depth range (m): 0 - 666.65
  Temperature range (°C): 3.715 - 10.151
  Nitrate (umol/L): 6.725 - 43.066
  Salinity (PPS): 31.657 - 34.331
  Oxygen (ml/l): 0.466 - 6.857
  Phosphate (umol/l): 0.943 - 3.284
  Silicate (umol/l): 14.539 - 102.211

Graphical representation

Depth range (m): 0 - 666.65

Temperature range (°C): 3.715 - 10.151

Nitrate (umol/L): 6.725 - 43.066

Salinity (PPS): 31.657 - 34.331

Oxygen (ml/l): 0.466 - 6.857

Phosphate (umol/l): 0.943 - 3.284

Silicate (umol/l): 14.539 - 102.211
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth Range: 5 to 950 m

Habitat: Rocky areas

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

The cushion starfish, as most starfish do, feed by inverting their stomachs to digest their food. P. tesselatus feed on a few types of sponges such as Chaonites latus, as well as hydroids, scallops and the bacteria that covers mussels (Zintheo, 1946).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

The process of reproduction is a continuous one and begins when the female pumps eggs out through the osculum. The males then spawn. The fertilized eggs float to the surface of the water. They are bright orange or yellow and measure 1.5mm in diameter. Each egg is covered with a coat of jelly, and the fertilization membrane can be seen beneath it. The egg then goes through several transformations in the plankton, and the five primordial arms appear simultaneously. Immediately, the larva sinks to the bottom and ends its planktonic life. The star can then crawl. Metamorphosis takes a total of aproximately thirty days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pteraster tesselatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TACTCTTTATTTAATTTTTGGGGCATGAGCTGGTATAATTGGTACTGCTATGAGAGTTATAATTCGAATTGAATTAACCCAACCTGGCTCTCTCCTTCAAGACGACCAAATTTATAATGTTATAGTTACAGCCCATGCTTTAATTATGATTTTCTTTATGGTAATGCCTATAATGATAGGAGGATTTGGAAATTGATTAATACCTCTAATGATTGGGGCTCCTGACATGGCTTTTCCACGAATGAACAACATGAGATTTTGATTAATTCCCCCTTCTTTTATACTATTACTTGCTTCCGCAAGTGTAGAAAGTGGTGCTGGAACCGGCTGAACTATTTATCCTCCCTTATCTAGAAAAATTGCCCATGCAGGAAGATCCGTAGACTTAGCCATATTTTCTCTTCATCTTGCTGGAGCTTCCTCTATTTTAGCATCTATTAAATTTATTACAACAATTATTAATATGCGTACTCCTGGAATTTCTTTTGACCGTTTACCTTTATTTGTTTGATCAGTTTTCATTACAGCTTTTTTACTCTTACTATCACTCCCCGTTCTAGCAGGAGCAATCACTATGCTTTTGACTGATCGAAAAATTAAAACTACTTTCTTTGACCCTGCTGGAGGAGGTGATCCTATATTATTTCAACACCTGTTTTGATTTTTTGGTCATCCCGAAGTTTATATTCTTATACTTCCAGGATTTGGTATGATATCTCATGTAATTGCTCATTATTCAAAAAAGACTGAACCTTTTGGATATTTAGGTATGGTATATGCTATTATCTCTATTGGTATATTAGGATTTTTAGTTTGAGCTCATCATATGT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pteraster tesselatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

The use of the cushion stars by humans has a negative influence on the ecosystem because of the disruption during the process of dragging for stars.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

The cushion stars are dried and then eaten as a source of food . They are also sold as souvenirs for tourists (Hess, 1978).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pteraster tesselatus

Pteraster tesselatus, the slime star or cushion star, is a species of starfish in the family Pterasteridae found in the North Pacific.

Description[edit]

The slime star is pentagonal in shape and has a wide central disc and five stumpy arms with upturned tips. It grows to a diameter of about 15 cm (5.9 in) and has an inflated appearance as the entire aboral (upper) surface is covered by a thick, raised, fleshy membrane. This has a smooth soft texture and is pale brown, grey, red, or orange, often with a symmetrical darker pattern. It conceals the madreporite and scales on the aboral surface proper and the gap underneath it is filled with a spongy tissue. A central pore in this membrane allows for water movement.[2][3] The arms have rows of fan-shaped groups of five to seven spines between which are two rows of tube feet. The red eyespot is surrounded by spines at the apex of each arm.[4]

Distribution and habitat[edit]

The slime star occurs in rocky areas on the west coast of North America from the Bering Sea southwards to central California at depths to 950 m (3,120 ft).[2] It is also known from the Aleutian Islands and Japan.[1] It is usually found in places where the current is strong.[4]

Biology[edit]

The slime star feeds on various benthic invertebrates, including the breadcrumb sponge (Halichondria panicea), the false jingle shell (Pododesmus macroschisma), other scallops and clams, and colonial sea squirts such as Aplidium and Didemnum species. It also feeds on the bacterial film that grows on the surface of mussels.[4] If attacked by a predator such as the morning sun star (Solaster dawsoni) or the sunflower star (Pycnopodia helianthoides), the slime star emits great quantities of repellent mucus and can often evade the predator.[3] The mucus is toxic and has been shown to kill other invertebrates immersed in it.[3]

The slime star breeds in the summer, with a female releasing a small number of eggs into the water. Nearby males then release sperm and the fertilised eggs rise to the surface of the water. They are bright orange or yellow and are wrapped in a gelatinous membrane. They become planktonic and pass through several developmental stages over the course of about 25 days. They then undergo metamorphosis into juvenile starfish and settle onto the seabed.[3][4]

One of several different species of polychaete worms often lives symbiotically within the ambulacral grooves on the oral (under) surface of the slime star.[4]

References[edit]

  1. ^ a b c Mah, C. (2012). "Pteraster tesselatus Ives, 1888". In C. L. Mah. World Asteroidea database. World Register of Marine Species. Retrieved 2012-09-22. 
  2. ^ a b Dave Cowles (2005). "Pteraster tesselatus Ives, 1888". Retrieved 2012-09-22. 
  3. ^ a b c d "Slime star (Pteraster tesselatus)". Seastars of the Pacific Northwest. 2011. Retrieved 2012-09-24. 
  4. ^ a b c d e "Pteraster tesselatus". Encyclopedia of Life. Retrieved 2012-09-24. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!