Physical Description
Type Information
Holotype for Pteraster jordani Fisher, 1905
Catalog Number: USNM 22343
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): United States Fish Commission
Year Collected: 1904
Locality: San Diego, Point Loma, California, United States, North Pacific Ocean
Depth (m): 1181 to 1189
Vessel: Albatross R/V
Catalog Number: USNM 22343
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): United States Fish Commission
Year Collected: 1904
Locality: San Diego, Point Loma, California, United States, North Pacific Ocean
Depth (m): 1181 to 1189
Vessel: Albatross R/V
- Holotype: Fisher. 1905. Bull. Bur. Fish., Wash. 24: 314.
© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Trusted
Ecology
Habitat
Depth range based on 9 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.
Environmental ranges
Depth range (m): 486 - 1800
Temperature range (°C): 2.553 - 6.140
Nitrate (umol/L): 39.811 - 43.448
Salinity (PPS): 34.301 - 34.523
Oxygen (ml/l): 0.321 - 0.766
Phosphate (umol/l): 3.193 - 3.305
Silicate (umol/l): 81.249 - 163.265
Graphical representation
Depth range (m): 486 - 1800
Temperature range (°C): 2.553 - 6.140
Nitrate (umol/L): 39.811 - 43.448
Salinity (PPS): 34.301 - 34.523
Oxygen (ml/l): 0.321 - 0.766
Phosphate (umol/l): 3.193 - 3.305
Silicate (umol/l): 81.249 - 163.265
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 4 samples.
Environmental ranges
Depth range (m): 486 - 1800
Temperature range (°C): 2.553 - 6.140
Nitrate (umol/L): 39.811 - 43.448
Salinity (PPS): 34.301 - 34.523
Oxygen (ml/l): 0.321 - 0.766
Phosphate (umol/l): 3.193 - 3.305
Silicate (umol/l): 81.249 - 163.265
Graphical representation
Depth range (m): 486 - 1800
Temperature range (°C): 2.553 - 6.140
Nitrate (umol/L): 39.811 - 43.448
Salinity (PPS): 34.301 - 34.523
Oxygen (ml/l): 0.321 - 0.766
Phosphate (umol/l): 3.193 - 3.305
Silicate (umol/l): 81.249 - 163.265
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Pteraster jordani
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 5 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 5 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
AGACGATGATTTTTTTCTACTAAACACAAGGATATTGGAACTCTTTATCTTATATTTGGAGCATGAGCCGGAATGGTTGGAACAGCAATGAGCGTAATAATCCGAACAGAACTTGCCCAACCTGGCTCCCTTCTTCAAGAT---GACCAAATTTACAAAGTAATAGTTACTGCTCACGCACTAGTAATGATATTTTTCATGGTTATGCCCATAATGATAGGAGGATTCGGAAAATGACTAATTCCACTCATGATAGGTGCCCCAGACATGGCATTCCCTCGAATGAAAAAAATGAGCTTTTGACTAATTCCTCCCTCTTTCCTACTACTTATTGCTTCCGCCGGAGTAGAAAGAGGAGCTGGAACCGGATGAACTATTATCCTCCCCTTTCCNNGAGGCCTAGCACACGCTGGAGGAAGAGTAGACCTTGCCATATTCTCTCTTCATCTAGCAGGAGCTTCTTCAATCCTAGCTTCTATAAAATTTATTACAACCATTATAAAAATGCGAACTCCCGGTGTTTCATTTGACCGCATGCCCCTCTTNGTATGATCTGTATTTGTAACTGCATTTTTANTTCTGCTTTCCTTACCAGTCCTTGCCGGGGCAATTACCATGTTACTAACAGACCGTAGAGTAAATACTACCTTCTTTGGTCCCGCCGGAGGGGGAGACCCTATACTATTTCAACACCTATTNTGATTTTTTGGTCACCCTGAAGTTTATATTCTTATTCTACCTGGATTCGGCATGATTTCCCACGTAGTAGCTCACTACGCTAAAAAGAGTGAACCCTTTGGGTATCTAGGTACGGTATATGCAATCATATCGATTGGAATTTTAGGATTTTTAGTTTGGGCCCATCATATGTTCACTGTTGGTATGGATGTA
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Pteraster jordani
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
