Physical Description

Type Information

Holotype for Pteraster jordani Fisher, 1905
Catalog Number: USNM 22343
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): United States Fish Commission
Year Collected: 1904
Locality: San Diego, Point Loma, California, United States, North Pacific Ocean
Depth (m): 1181 to 1189
Vessel: Albatross R/V
  • Holotype: Fisher. 1905. Bull. Bur. Fish., Wash. 24: 314.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 9 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 486 - 1800
  Temperature range (°C): 2.553 - 6.140
  Nitrate (umol/L): 39.811 - 43.448
  Salinity (PPS): 34.301 - 34.523
  Oxygen (ml/l): 0.321 - 0.766
  Phosphate (umol/l): 3.193 - 3.305
  Silicate (umol/l): 81.249 - 163.265

Graphical representation

Depth range (m): 486 - 1800

Temperature range (°C): 2.553 - 6.140

Nitrate (umol/L): 39.811 - 43.448

Salinity (PPS): 34.301 - 34.523

Oxygen (ml/l): 0.321 - 0.766

Phosphate (umol/l): 3.193 - 3.305

Silicate (umol/l): 81.249 - 163.265
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pteraster jordani

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AGACGATGATTTTTTTCTACTAAACACAAGGATATTGGAACTCTTTATCTTATATTTGGAGCATGAGCCGGAATGGTTGGAACAGCAATGAGCGTAATAATCCGAACAGAACTTGCCCAACCTGGCTCCCTTCTTCAAGAT---GACCAAATTTACAAAGTAATAGTTACTGCTCACGCACTAGTAATGATATTTTTCATGGTTATGCCCATAATGATAGGAGGATTCGGAAAATGACTAATTCCACTCATGATAGGTGCCCCAGACATGGCATTCCCTCGAATGAAAAAAATGAGCTTTTGACTAATTCCTCCCTCTTTCCTACTACTTATTGCTTCCGCCGGAGTAGAAAGAGGAGCTGGAACCGGATGAACTATTATCCTCCCCTTTCCNNGAGGCCTAGCACACGCTGGAGGAAGAGTAGACCTTGCCATATTCTCTCTTCATCTAGCAGGAGCTTCTTCAATCCTAGCTTCTATAAAATTTATTACAACCATTATAAAAATGCGAACTCCCGGTGTTTCATTTGACCGCATGCCCCTCTTNGTATGATCTGTATTTGTAACTGCATTTTTANTTCTGCTTTCCTTACCAGTCCTTGCCGGGGCAATTACCATGTTACTAACAGACCGTAGAGTAAATACTACCTTCTTTGGTCCCGCCGGAGGGGGAGACCCTATACTATTTCAACACCTATTNTGATTTTTTGGTCACCCTGAAGTTTATATTCTTATTCTACCTGGATTCGGCATGATTTCCCACGTAGTAGCTCACTACGCTAAAAAGAGTGAACCCTTTGGGTATCTAGGTACGGTATATGCAATCATATCGATTGGAATTTTAGGATTTTTAGTTTGGGCCCATCATATGTTCACTGTTGGTATGGATGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pteraster jordani

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!