Overview

Comprehensive Description

Description

 A small starfish (up to 5 cm) with 5 (rarely 4 or 6) very short, broad-based arms. Upper surface covered with groups of short stiff spines. Colour variable but usually brown, green or orange; mottled individuals are present in some populations. The predominant colour pattern varies from area to area and with habitat, specimens from lower shore situations generally being paler in colour.Asterina gibbosa is a protandrous hermaphrodite: small or young individuals are males but as they become older and increase in size they develop into females. Asterina gibbosa may be distinguished from the morphologically similar Asterina phylactica which has a consistent colour pattern with a brown central star typically overlying the general background colour. There are rarely spines on the mouth plates of Asterina phylactica.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

A small flattened, cushion star, the dorsal surface is rough with projecting spines and most specimens are green in colour. There is often orange coloration along the margin of the arms. The dorsal surface is covered with groups of short spinelets, usually orange in colour. Up to 5cm. across. Asterina phylactica is very similar but smaller and may be commoner sublittorally and in large rockpools.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

The cushion star inhabits the regions of Europe's rocky coasts, most commonly the seas to the south and west of the British Isles.

Biogeographic Regions: atlantic ocean (Native )

  • Nichols, D., J. Cooke. 1971. The Oxford Book of Invertebrates. Oxford: Oxford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

From the lower shore to about 125 m depth, on rocky shores, under overhangs, under stones and in rock pools, western coast s of British Isles, inclluding the Isle of Man, from Scotland to Dorset
  • Southward, E.C.; Campbell, A.C. (2006). [Echinoderms: keys and notes for the identification of British species]. Synopses of the British fauna (new series), 56. Field Studies Council: Shrewsbury, UK. ISBN 1-85153-269-2. 272 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Found on all western and southern coasts of the British Isles but not on North Sea coasts.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Asterina gibbosa is a pentagonal shape with five short arms and a diameter up to 6 cm. The tiny, blunt-armed cushion star ranges in color from greenish-gray, yellowish-green, to reddish-brown. The asteroids are considered a slow moving species with the cushion star being the slowest among all, moving approximately 2.5 cm per minute. The cushion star resembles its given name since the body appears to be inflated like a pillow cushion, emphasizing it small size and blunt arms. The class that the cushion star belongs to, Crinoidea, has retained an upwardly-directed mouth. The cushion star has a body consisting of a tiny central disk to carry the main organs. The mouth of the cushion star is located in the center of the underside. Located on the underside of each arm are grooves that lead to the center that contain hundreds of tube-feet.

Other Physical Features: ectothermic ; heterothermic ; radial symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

The cushion star commonly occupies shallow rock pools underneath stones, boulders, and overhangs that provide shelter. Other preferred sites include nestling among algae, sponge masses, or on cliff faces. The cushion star is vertically distributed between the depths of sea level and the intertidal to 130 meters, yet littoral cushion stars are only found in rock pools and relatively damp habitats. This vertical distribution may be extended on shores with rock pools, but this extension will not go beyond the high-water-neap-tide level due to an intolerance to dessication at high temperature, inadequate food supply, and complex behavioral responses to gravity and light. Comparative studies on the ecology of the cushion star at Lough Line showed that A. gibbosa are found in the rocky shallow sub-littoral in varying abundance, yet it was absent from any of the outer shore sites.

Range depth: 130 (high) m.

Habitat Regions: temperate ; saltwater or marine

Aquatic Biomes: temporary pools; coastal

Other Habitat Features: intertidal or littoral

  • Emson, R., R. Crump. 1984. Comparitive Studies on the Ecology of *Asterina Gibbosa* and *A. Phylactica* at Lough Line. Journal of the Marine Biological Association of the United Kingdom, 64: 35-53.
  • Grzmek, B. 1972. Grzmik's Animal Life Encyclopedia. New York: Van Nostrand Reinhold Company.
  • Murphy, C., M. Jones. 1987. Some Factors Affecting the Respiration of Intertidal *Asterina Gibbosa*. Journal of the Marine Biological Association of the United Kingdom, 67: 717-727.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 113 specimens in 1 taxon.
Water temperature and chemistry ranges based on 28 samples.

Environmental ranges
  Depth range (m): 0 - 48
  Temperature range (°C): 11.471 - 19.656
  Nitrate (umol/L): 0.875 - 7.121
  Salinity (PPS): 35.184 - 37.969
  Oxygen (ml/l): 5.255 - 6.200
  Phosphate (umol/l): 0.229 - 0.439
  Silicate (umol/l): 1.778 - 3.285

Graphical representation

Depth range (m): 0 - 48

Temperature range (°C): 11.471 - 19.656

Nitrate (umol/L): 0.875 - 7.121

Salinity (PPS): 35.184 - 37.969

Oxygen (ml/l): 5.255 - 6.200

Phosphate (umol/l): 0.229 - 0.439

Silicate (umol/l): 1.778 - 3.285
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 Found under boulders and stones on the lower shore on sheltered and semi-exposed rocky coasts and also in rockpools. Extends into the sublittoral to depths of about 100 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

A characteristic intertidal form commonly found under boulders or in crevices on rocky shores. Sometimes found in shallow water in sheltered localities.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Cushion stars are omnivorous. As with other starfish A. gibbosa feed themselves by inverting their stomachs in order to digest the food they eat. Their diet includes molluscs, worms and ophiuroids that are also found among rocky shores. They also eat microorganisms, decaying seaweeds and dead invertebrates.

Animal Foods: carrion ; mollusks; aquatic or marine worms; echinoderms; other marine invertebrates

Plant Foods: macroalgae

Other Foods: detritus ; microbes

Primary Diet: carnivore (Eats non-insect arthropods, Molluscivore , Vermivore, Eats other marine invertebrates); omnivore ; detritivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Starfish are most vulnerable in their larval stage. Few young survive to adulthood.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

In general, echinoderms have nerve nets and non-centralized nervous systems. Asteroids have optic cushions, or eyespots, and respond to light. Echinoderms in general respond to chemicals, light and touch.

Communication Channels: chemical

Other Communication Modes: pheromones

Perception Channels: visual ; tactile ; chemical

  • Brusca, R., G. Brusca. 2003. Invertebrates. Sunderland, Massachusetts: Sinauer Associates, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeding

Protandrous hermaphrodite; eggs are laid in creviices, but are not brooded. Summer
  • Southward, E.C.; Campbell, A.C. (2006). [Echinoderms: keys and notes for the identification of British species]. Synopses of the British fauna (new series), 56. Field Studies Council: Shrewsbury, UK. ISBN 1-85153-269-2. 272 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Eggs are usually laid on the underside of stones by female Asterina gibbosa. Up to three weeks later, the young hatch bipinnaria and later into brachiolaria larvae. The larvae are bilaterally symmetrical and metamorphose into juveniles.

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Cushion stars can live up to seven years.

Typical lifespan

Status: wild:
7 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

The cushion star is one of the few sequential hermaphroditic echinoderms. Younger and smaller individuals are males, developing into females as they increase in size and age. Male and female gametes are not readily distinguishable to the naked eye. One would have to see the gonads or see them actually spawning. The gonads on the cushion star are located in each arm. These gonads release the gametes through gonaducts that are located on the central body between the arms. The male gametes are produced first and later only female gametes are produced. Female A. gibbosa deposit up to 1000 eggs in a specific location (usually underside stones) to the ground in the process of reproduction. At the beginning of reproduction, many starfish belonging to the asteroid species form aggregations. In Asterina gibbosa, several males surround or congregate around one female during reproduction.

Range number of offspring: 1000 (high) .

Key Reproductive Features: sequential hermaphrodite (Protandrous ); sexual ; fertilization ; oviparous

There is no post-spawning parental investment.

Parental Investment: pre-fertilization (Provisioning)

  • Grzmek, B. 1972. Grzmik's Animal Life Encyclopedia. New York: Van Nostrand Reinhold Company.
  • Nichols, D., J. Cooke. 1971. The Oxford Book of Invertebrates. Oxford: Oxford University Press.
  • Skewes, M. 11/10/2002. "Asterina gibbosa. A cushion star" (On-line). Marine Life Information Network: Biology and Sensitivity Key Information Sub-programme. Accessed December 14, 2004 at http://www.marlin.ac.uk/species/Asterinagibbosa.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Asterina gibbosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

AAACGATGATTTTTTTCTACTAAACACAAGGACATAGGTACTCTATATCTTATATTTGGAGCCTGGGCCGGAATGGCCGGAACTGCAATGAGCGTTATCATACGAACAGAACTAGCACAACCAGGGTCACTTCTCCAAGAC---GACCAAATTTATAAAGTCATAGTAACCGCTCACGCACTGGTTATGATTTTCTTTATGGTAATGCCCATAATGATTGGAGGATTCGGTAACTGATTGATTCCACTAATGATTGGGGCCCCAGACATGGCTTTTCCTCGAATGAATAAAATGAGATTTTGATTGATACCACCTTCTTTTCTTCTACTCCTTGCCTCCGCCGGAGTAGAGAGTGGAGCAGGTACAGGTTGGACAATCTACCCCCCACTTTCCAGTGGACTGGCACATGCGGAAGGCTCTGTAGATCTAGCAATATTTTCCCTTCACCTTGCTGGAGCATCCTCAATCCTTGCCTCTATTAAATTTATTACTACTATCATTAATATGCGAACCCCTGGAATGTCTTTTGACCGCCTTCCCCTGTTTGTGTGATCAGTATTCGTTACTGCCTTTCTCTTAGTATTATCCCTTCCGGTATTGGCTGGTGCCATAACTATGCTACTCACAGACCGAAAAATTAATACCACCTTCTTTGACCCTGCCGGAGGTGGAGACCCAATTCTCTTCCAACATTTATTTTGATTCTTCGGTCACCCCGAAGTTTATATTCTCATTCTCCCGGGATTTGGAATGATCTCCCACGTTATCGCCCACTACTCTGGAAAGAGCGAACCCTTTGGATATTTAGGAATGGTTTACGCCATCGTCTCCATAGGGATCCTGGGATTTTTAGTTTGGGCCCACCATATGTTTACAGTCGGAATGGACGTTGACACTCGTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Asterina gibbosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

The species is not threatened, but an oil spill at the entrance to Milford Haven in February 1996 spread of 70,000 tons of oil along the Pembrokeshire coast. This location had a major population of Asterina gibbosa which was greatly affected because of the spill. However, observations were made eight weeks after the incident, and there was a good survival of the larger Asterina gibbosa, even some living near small pockets of oil underneath rocks.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

The cushion star does not have any adverse effects on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The cushion star does not have any positive effects on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Asterina gibbosa

Asterina gibbosa, commonly known as the starlet cushion star, is a species of starfish in the family Asterinidae. It is native to the northeastern Atlantic Ocean and the Mediterranean Sea.

Description[edit]

Asterina gibbosa is a pentagonal starfish with short blunt arms and an inflated appearance. The aboral (upper) surface is clothed in groups of short, blunt spines. This starfish grows to a diameter of about 5 centimetres (2.0 in) and may be brown, green or orange. It is sometimes blotched with colour and individuals from deeper sea locations tend to be paler in colour. It can be distinguished from the closely related Asterina phylactica by the fact that it has two small spines on each of the plates surrounding its mouth, A. phylactica having no spines on these plates and having a plain olive-green aboral surface with a brown central star.[2] A. gibbosa, at 5 centimetres (2.0 in) is considerably bigger than A. phylactica which seldom exceeds 15 mm (0.6 in). At one time the two were believed to be the same species but it was realised in 1979 that besides the differences in appearance, the two occupied different ecological niches and had different reproductive strategies.[3]

Biology[edit]

Tip of arm showing eyespot

Asterina gibbosa is mainly nocturnal, spending the day underneath boulders, overhangs or in caves, or hidden away under algae in rock pools. It is an opportunistic scavenger but the bulk of its diet comes from the film of bacteria and diatoms that exist on the surface of rocks. It feeds by everting its stomach (turning it inside out) against the surface of the rock and secreting enzymes which digest the film. Other foods found in its stomach included decaying toothed wrack (Fucus serratus), periwinkle faeces and bits of dead molluscs such as mussels (Mytilus edulis), oysters (Ostrea edulis) and periwinkles (Littorina littorea), but 95% of the stomachs contained no large particles indicating the importance in its diet of microscopic organisms.[3]

Asterina gibbosa is a protandric hermaphrodite. This means that it is born a male and later changes sex and becomes a female. Researchers found that at Plymouth, United Kingdom, the sex change happens when it has an arm length somewhere between 9 and 16 millimetres (0.35 and 0.63 in). Other researchers at Naples, Italy found that Mediterranean populations did not have such a clearcut change of sex. In the first year cohort, with arms averaging 11 millimetres (0.43 in), about 80% were male. In the second year batch, with arms averaging 17 millimetres (0.67 in), about 30% were male. By the third year, with 25 millimetres (0.98 in) arms, males were very scarce, but in even larger individuals of unknown age, about 15% were male.[4] Asterina gibbosa may live for six years or more.[5]

The eggs of Asterina gibbosa are laid in a mass and glued to the substrate by their jelly-like coating. Each developing embryo feeds on its egg yolk and hatches directly into a brachiolaria larva, without the intervening mobile planktonic phase of most starfish larvae. The larva has a pair of asymmetric arms which gradually lengthen, and an adhesive disc with which it cements itself to the seabed. It then undergoes metamorphosis, its arms are reabsorbed and tube feet develop and take on the role of anchoring it to the seabed. Later the mouth of the juvenile starfish develops and it is able to start feeding.[6]

Distribution and habitat[edit]

Asterina gibbosa is found in the northeastern Atlantic Ocean and the Mediterranean Sea. Its range extends from Scotland, Ireland and the southern North Sea southwards to the Mediterranean Sea, Morocco, Tunisia, the Azores, Cape Verde Islands, the Canary Islands and Madeira. It is found from the lower shore down to a depth of about 125 metres (410 ft) in pools, on rocks, under boulders and overhangs.[1]

References[edit]

  1. ^ a b Mah, C.; Hansson, H. (2013). "Asterina gibbosa (Pennant, 1777)". World Register of Marine Species. Retrieved 2013-10-29. 
  2. ^ Skewes, Marie (2008). "Asterina gibbosa". Marine Life Information Network. Retrieved 2013-10-29. 
  3. ^ a b Crump, R. G.; Emson, R. H. (1983). "The natural history, life history and ecology of the two British species of Asterina". Field Studies 5 (5): 867–882. 
  4. ^ Bacci, Guido (1951). "On two sexual races of Asterina gibbosa (Penn.)". Experientia 7 (1): 31–33. doi:10.1007/BF02165480. 
  5. ^ Crump, Robin (2008). "Cushion stars". The Seashore. Field Studies Council. Retrieved 2013-10-31. 
  6. ^ Haesaerts, Delphine; Jangoux, Michel; Flammang, Patrick (2006). "Adaptations to benthic development: functional morphology of the attachment complex of the brachiolaria larva in the sea star Asterina gibbosa". Biological Bulletin 211 (2): 172–182. doi:10.2307/4134591. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!