Ecology

Habitat

Depth range based on 2 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 131.5 - 151.5

Graphical representation

Depth range (m): 131.5 - 151.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Asterina miniata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCCTTTATCTTATCTTTGGAGCCTGAGCTGGGATGGCCGGAACAGCAATGAGTGTAATAATACGGACAGAACTAGCACAGCCTGGATCCTTACTACAAGACGACCAAATATACAAAGTAATAGTTACTGCACACGCCCTAGTCATGATATTCTTCATGGTAATGCCAATTATGATTGGAGGATTCGGAAACTGACTAATACCGTTAATGATCGGAGCCCCTGACATGGCCTTTCCCCGAATGAACAATATGAGATTCTGACTAATTCCCCCATCCTTTCTACTTTTATTAGCTTCCGCAGGCGTGGAAAGAGGAGCCGGAACAGGATGAACAATCTACCCCCCATTATCTAGAGGATTAGCCCACGCTGGAGGATCAGTAGACTTAGCAATATTTTCCCTTCACCTAGCGGGAGCTTCCTCAATACTTGCCTCAATAAAATTCATAACAACTGTTATAAAAATGCGAACACCAGGAATTTCATTTGACCGACTTCCTTTGTTTGTATGGTCAGTATTCGTAACAGCTTTCCTGCTCCTTCTATCCTTACCAGTACTTGCAGGTGCAATAACAATGCTTCTTACAGACCGAAAAGTTAATACCACCTTTTTCGACCCCGCAGGAGGGGGAGACCCTATCTTATTTCAACACTTATTCTGATTCTTTGGCCACCCAGAAGTTTACATTCTTATTCTTCCTGGATTTGGAATGATCTCTCACGTAATCGCCCACTACGCAGGAAAGAGAGAACCATTTGGTTATCTCGGAATGGTCTACGCCATAGTTTCTATTGGAATTCTAGGGTTTTTAGTTTGAGCCCACCACATGTTTACAGTCGGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Asterina miniata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Bat star

The Bat star (Patiria miniata), also known as Sea bat, Webbed star,Bat Man and Broad-disk star, is an echinoderm of class Asteroidea (commonly known as sea stars). It typically has five arms, with the center disk of the animal being much wider than the stubby arms are in length.[2] Although the bat star usually has five arms, it sometimes has as many as nine.[3] Bat stars occur in many of colors, including green, purple, red, orange, yellow and brown, either mottled or solid.[3] The bat star gets its name from the webbing between its arms, which is said to resemble a bat's wings.[4]

The bat star is usually found in the intertidal zone at an average depth of 79 metres (259 ft).[5] Its range extends from Sitka, Alaska to Baja California in the Pacific Ocean.[3] It is most abundant along the coast of Central California and the Monterey Bay.[2]

Contents

Anatomy

Bat Stars can be many different types of colors.The bat star breathes through gill-like structures on its back that perform as respirators. It lacks the pincers or pedicellariae that most starfish use to clean the skin surface of debris, but its small, moving hairs or cilia may create enough of a water current to keep the surface of its skin clean.[5] It has visual sensors at the end of each ray that can detect light and note prey. To eat its prey, it covers the prey with its stomach and oozes digestive juices over it; this liquefies the food, enabling the bat star to ingest it.[3] It is omnivorous, eating both plants and animals alive or dead.[6]

Reproduction

The bat stars reproduce through spawning. The male casts sperm and the female drops eggs; each has pores at the base of the rays for this purpose. The sperm and egg unite at sea and are carried away by ocean currents.[3]

Behavior

Bat stars may gently "fight" with each other if they meet. Fighting behavior consists of pushing and laying an arm over the other.[2][3]

Importance

Bat stars are important as detritivores and scavengers, collecting algae and dead animals from the ocean floor and helping keep the ocean healthy.[3]

Notes

  1. ^ "Asterina miniata". Integrated Taxonomic Information System. Retrieved 29 November 2009. 
  2. ^ a b c "Asterina miniata". www.wallawalla.edu. Retrieved 2009-11-22. 
  3. ^ a b c d e f g "Bat star, Kelp Forest, Invertebrates, Asterina miniata". www.montereybayaquarium.org. Retrieved 2009-11-22. 
  4. ^ "Bat Star: Asterina miniata". northislandexplorer.com. Archived from the original on 21 November 2009. Retrieved 2009-11-22. 
  5. ^ a b "Asterina miniata (Broad-Disk Star)". zipcodezoo.com. Retrieved 2009-11-22. 
  6. ^ "sea stars". biology.fullerton.edu. Archived from the original on 23 November 2009. Retrieved 2009-11-26. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!