Overview

Comprehensive Description

Description

A stiff rigid starfish with a sandpapery texture to the dorsal surface. This species comes in a variety of colour forms, purple being the most common. It is only distinguished from the next species by the very fine dorsal spinelets which have 3-6 glassy points. Usually about 12cm across. It may be impossible to distinguish this species from Henricia oculata except in the laboratory.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

From low intertidal to 50 m depth, typical of the algal zone. British distribution not completely known, but it certainly occurs in Orkney, Shetland and north-east Scotland.
  • Southward, E.C.; Campbell, A.C. (2006). [Echinoderms: keys and notes for the identification of British species]. Synopses of the British fauna (new series), 56. Field Studies Council: Shrewsbury, UK. ISBN 1-85153-269-2. 272 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Arctic to Cape Hatteras
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Henricia sanguinolenta is most often found in the North Atlantic and North Pacific oceans. It can be seen from Greenland to Cape Hatteras on the western side of the Atlantic. It is frequently found on the west coast of Scotland.

Biogeographic Regions: atlantic ocean (Native ); pacific ocean (Native )

  • Boolootian, R. 1966. Physiology of Echinodermata. New York, London, Sydney: Interscience Publishers.
  • Buchsbaum, R., L. Milne. 1960. The Lower Animals; Living Invertebrates of the World. London: Hamish Hamilton.
  • Picton, B., C. Morrow. 2004. "Encyclopedia of Marine Life of Britain and Ireland" (On-line). Henricia sanguinolenta. Accessed 07/14/04 at http://www.habitas.org.uk/marinelife/species.asp?item=ZB1660.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

A northern species in the British Isles probably occurring with Henricia oculata on the west coast of Scotland.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Henricia sanguinolenta can be found in a variety of different colors, but it is very often seen in a rich red color, which is how it acquired the common name of blood star. It can also be colored purple, lavender, orange, or yellow. A similar species, Henricia oculata is almost indistinguishable from H. sanguinolenta, but has the spines on the former's dorsum are blunt. The blood star grows to a diameter of 7 to 10 centimeters. It has five rays or arms which taper evenly to the tips, no marginal plates, two tube foot rows, and no pedicellaria. Henricia sanguinolenta has a sandpapery texture and fine spinelets with 3 to 6 glassy points on its dorsal surface. The sides of it arms are curved smoothly, with no clear distinction between dorsal and ventral surface, and each has a narrow ambulacral groove which contains the tube feet.

Range length: 7 to 10 cm.

Other Physical Features: ectothermic ; heterothermic ; radial symmetry

Sexual Dimorphism: sexes alike

  • Pollock, L. 1998. A Practical Guide to the Marine Animals of Northeastern North America. New Brunswick, New Jersey and London: Rutgers University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Found at depths of 0-2414 m. Prefer rock and algae covered substrate.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The blood star can often be found along the shore, on or beneath rocks and on gravel. It may live in a somewhat exposed habitat, and is often found living in the midst of some species of sponges. Henricia sanguinolenta can inhabit shallow waters and ranges down as deep as 365 m.

Range depth: 365 (high) m.

Habitat Regions: temperate ; polar ; saltwater or marine

Aquatic Biomes: benthic ; coastal

  • Nicholas, D., J. Cooke. 1971. The Oxford Book of Invertebrates. Oxford: Oxford University Press.
  • Pratt, H. 1935. A Manual of the Common Invertebrate Animals Exclusive of Insects. Philadelphia: P. Blakiston's Son & Co., Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 852 specimens in 1 taxon.
Water temperature and chemistry ranges based on 473 samples.

Environmental ranges
  Depth range (m): -3 - 3437
  Temperature range (°C): -1.315 - 24.323
  Nitrate (umol/L): 0.757 - 43.616
  Salinity (PPS): 31.813 - 36.439
  Oxygen (ml/l): 0.303 - 8.023
  Phosphate (umol/l): 0.118 - 3.251
  Silicate (umol/l): 1.328 - 134.446

Graphical representation

Depth range (m): -3 - 3437

Temperature range (°C): -1.315 - 24.323

Nitrate (umol/L): 0.757 - 43.616

Salinity (PPS): 31.813 - 36.439

Oxygen (ml/l): 0.303 - 8.023

Phosphate (umol/l): 0.118 - 3.251

Silicate (umol/l): 1.328 - 134.446
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurs in a variety of moderately exposed and exposed habitats on rocks and amongst hydroids, sponges, etc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

This species of sea star feeds on suspended material using the filter-feeding, but also sometimes consumes the tissues of sponges, ascidians and other sessile invertebrates.

Animal Foods: cnidarians; other marine invertebrates

Other Foods: detritus

Foraging Behavior: filter-feeding

Primary Diet: carnivore (Eats other marine invertebrates); planktivore

  • Dijkstra, J., L. Harris, E. Westerman. 2006. Distribution and long-term temporal patterns of four invasive colonial ascidians in the Gulf of Maine. Journal of Experimental Marine Biology and Ecology, 342(1): 61-68.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Breeding

Broods young. Spring
  • Southward, E.C.; Campbell, A.C. (2006). [Echinoderms: keys and notes for the identification of British species]. Synopses of the British fauna (new series), 56. Field Studies Council: Shrewsbury, UK. ISBN 1-85153-269-2. 272 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diet

Feeds on organic particles and dissolved nutrients (absorbed through its skin)
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Henricia sanguinolenta is considered a stable gonochoric. In other words, it has separate sexes and the ratio of the sexes is approximately equal. This species generally reproduces between the months of February and May. It migrates into shallower, warmer water during the breeding season. Its eggs are kept beneath the disk of the sea star to incubate. The female deposits her eggs on the ocean floor and situates herself over the eggs with her body raised for three weeks. The eggs are covered in sticky mucus, so they remain tightly together. The parent fasts during this brooding period as well.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

This species is one of the few sea stars that broods its eggs until they become independent. The larvae of H. sanguinolenta do not go through the free-swimming larval stage as most sea star larvae do. They continue to live enlosed in the dome created by the parent's arms until they grow into tiny sea stars that can survive on their own.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Female); pre-independence (Protecting: Female)

  • Boolootian, R. 1966. Physiology of Echinodermata. New York, London, Sydney: Interscience Publishers.
  • Buchsbaum, R., L. Milne. 1960. The Lower Animals; Living Invertebrates of the World. London: Hamish Hamilton.
  • Grzimek, D. 1972. Grzimek's Animal Life Encyclopedia Volume 3: Mollusks and Echinoderms. New York: Van Nostrand Reinhold Company.
  • Nicholas, D., J. Cooke. 1971. The Oxford Book of Invertebrates. Oxford: Oxford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Henricia sanguinolenta

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTCTATATCTTATATTTGGGGCCTGGGCCGGAATGGTTGGAACAGCCATGAGAGTTATTATACGAACAGAATTAGCCCAGCCCGGATCCCTACTACAAGATGACCAAATATACAAAGTAATAGTAACAGCTCACGCTTTAGTTATGATATTCTTCATGGTGATGCCAATCATGATTGGAGGATTTGGAAACTGATTAGTCCCCTTAATGATAGGAGCCCCCGACATGGCCTTCCCACGAATGAACAAAATGAGATTTTGACTAATACCCCCATCATTTCTGCTACTCCTAGCCTCTGCCGGGGTAGAAAGAGGAGCCGGTACTGGTTGAACAATGTATCCCCCACTGTCTAGTGGATTAGCCCACGCAGGAGGATCTGTAGACCTCGCAATATTCTCACTCCATCTAGCCGGAGCATCCTCAATTCTTGCCTCCATTAATTTTATTACCACAATAATAAAAATGCGCACCCCCGGTGTATCCTTCGACCGATTACCTTTATTCGTCTGATCAATATTTGTCACAACCTTCCTTCTGCTCCTCTCATTACCCGTACTAGCAGGTGCAATCACCATGTTATTAACAGACCGAAAAGTGAAAACTACTTTCTTCGACCCTGCAGGAGGAGGAGACCCAATTCTATTTCAACACCTCTTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Henricia sanguinolenta

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Henricia sanguinolenta is not considered an endangered or threatened species.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of Henricia sanguinolenta on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Henricia sanguinolenta does not have any substantial direct impacts on human prosperity or health. It is known to feed on to feed on invasive species of ascidians in North America (Djikstra et al., 2006). It is nonetheless a bright and colorful seastar that can be viewed by visitors along the shore line.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Henricia sanguinolenta

Henricia sanguinolenta, commonly known as the northern henricia or bloody henry, is a species of sea star from the North Atlantic and North Pacific oceans. Henricia sanguinolenta is very similar to Henricia oculata, and the two can only be distinguished by laboratory tests. It comes in colors of red, yellow, orange, purple, and lavender.

Habitat[edit]

Henricia sanguinolenta is found in the North Atlantic and North Pacific oceans. The sea star can be seen on the beach, under rocks, in tidal pools when available, and on gravel. Its aquatic biomes are the coastal and benthic zones. The sea star is almost always found near sponges and coral because of the currents they create, making it easier for the sea star to filter feed. Henricia sanguinolenta is found from depths of 0 to 2414 meters.

Diet[edit]

Henricia sanguinolenta is a planktivore and carnivore. The sea star filter feeds upon detritus and plankton floating in the water, and uses currents made by sponges or coral to make this process easier. Henricia feeds on plankton, sponge tissue, ascidians, and other invertebrates. It is eaten by vertebrates.

Reproduction[edit]

Sexual reproduction

Henricia sanguinolenta is a stable gonochoric. The sea star usually reproduces during February and May. The sea stars migrate to warm, shallow water during the breeding season. The sea stars mate through disk fusion. The eggs are then kept under the disk of the female starfish to incubate after fertilization occurs. After incubation, the female deposits its eggs on the ground, secretes mucus onto them, and then stays on top of the eggs for three weeks while they hatch. The sea stars are polygamous. Henricia sanguinolenta has a diploid chromosome number of 36.

Asexual reproduction

Although Henricia sanguinolenta can reproduce sexually, it can also reproduce asexually. It reproduces asexually through the process of regeneration. The sea star can go through regeneration if the disc is split in half, or even if a ray is cut off. The regeneration process takes weeks to months to complete.

Anatomy[edit]

Rays

Henricia sanguinolenta is an invertebrate. It has slender five rays that taper evenly to tips that are connected by a central disc. The sea star grows to a diameter of 5 to 12 centimeters. On the oral side, the rays are smooth and have an ambulacral groove that contains two tube foot rows. On the dorsal side, the rays are rough with groupings of spinelets, each one have three to six glassy points. The sides of the rays are curving and smooth. The rays contain many of the organs in the sea star. On the tips of the rays are the eyespots. These are dark pigmented organs that sense the presence of light. The rays also contain parts of the pyloric stomach, parts of the nervous system, and most other organs.

Tube foot rows

The tube foot rows are on the oral side of the rays. Each ray has two tube foot rows. The tube foot rows are attached to the rays by ambulacral grooves. The Tube Foot Rows use a chemical adhesive to stick to surfaces instead of suction. The tube foot rows help the sea star stick to its prey, and to bring the prey to its mouth. The tube foot rows also aid in gas exchange. the tube foot rows are sensitive to chemicals enabling the sea star to detect chemical trails left by possible food. The tube foot rows also excrete waste ammonia through diffusion.

Nervous system

Henricia sanguinolenta has no brain, but has a nervous system. The sea star has no capacity for planning. The nervous system has two parts. They are motor system and the sensory system which are interconnected by neurons. The motor system is responsible for movement and functioning and the sensory system is responsible for controlling the sensory organs. Both of these systems run up and down the arms, and around the disc.

Vascular tube system

Henricia sanguinolenta, like all other sea stars, uses water instead of blood. Henricia sanguinolenta pumps filtered seawater in and out of its body. This seawater is transported through a vascular tube system, and delivers nutrients to the different organs and helps in gas exchange. Water enters through the madreporite, a sieve-like structure on the oral side.

Body wall

The body wall is composed of epidermis,dermis, thin cuticle, and a thin coelomic myoepithelial layer.

Digestive system/stomachs

Henricia sanguinolenta has two stomachs, a small intestine, and an rectum leading to an anus. The two stomachs are called the cardiac stomach, and the pyloric stomach. The cardiac stomach is on the oral side, in the center of the disc. It is covered by a thin membrane and sphincter. When the sea star has its prey, it extends the stomach to envelope the prey. Once the prey is enveloped, it then retracts back into the disc, and transfers it to the pyloric stomach for further digestion. The pyloric stomach has two extensions into each arm called the pyloric caeca. These secrete digestive enzymes into the pyloric stomach. Then, the waste is transported through a short intestine, and rectum. The material that is left is secreted through a small anus on the oral side of the disc.

Papulae

The papulae are small are small gills on the rays and disc. Waste ammonia is transported to the tips of the papulae using phagocytic cells, and is then excreted.

Circulatory System

Henricia sanguinolenta has a circulatory system that forms three rings of vessels. They are called the hyponeural haemal ring, the gastric ring, and the genital ring. The heart beats six times every minute and connects all three vessels. At the base of each ray, there is a pair of gonads.

Behavior[edit]

Henricia sanguinolenta shows behavioral adaptations in addition to physical ones. The sea star is usually seen with sponges and coral, using the currents they make to feed upon detritus. Henricia sanguinolenta is also one of the only species of sea stars that broods its eggs. The female stays with the eggs while they hatch, and continues to stay with them as larvae. The larvae stay in a dome shape created by the female's arms until they are ready to go into the ocean on their own. Until spring time, Henricia sanguinolenta lives a solitary life. Henricia sanguinolenta also doesn't react to the fluid of Asterias forbesi, which is toxic to most other sea stars.

Impact on Humans[edit]

Henricia sanguinolenta has no negative or positive impact on humans. The sea star is not harmful to humans or the economy, and only may slightly affect the tourist industry with its bright colors.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!