You are viewing this Species as classified by:

Overview

Brief Summary

WhyReef - Lifestyle

The crown-of-thorns sea star is an echinoderm, which means “spiny skin.” Hiding itself in crevices in the reef during the day, this starfish likes to crawl around on the reef in huge groups of 20-200 individuals. It can move around easily using its muscular tube feet, which it also uses to collect food. At the end of each of its arms it has an eyespot. It cannot see shapes or colors with its eyespots, but it can see changes between light and dark.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Acanthaster planci in its current usage does not in fact refer to a single species, but a pan-Indo-Pacific species complex consisting of four deeply diverged clades (Pacific, Red Sea, Northern Indian Ocean, and Southern Indian Ocean; see Vogler et al., 2008). These clades reportedly diverged between 1.95 and 3.65 Million years ago (Pliocene to Early Pleistocene) and have genetic distances (8.8 to 10.6 %) equivalent to the distances between other sibling species of starfish (Waters et al. 2004). Vogler et al. (2008) propose that this speciation process was driven by sea level changes (Pillans et al., 1998), isolating populations.

Vogler C, Benzie J, Lessios H, Barber P, Wörheide G (2008). "A threat to coral reefs multiplied? Four species of crown-of-thorns starfish". Biology Letters (Royal Society) 4: 696.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Coppard , Simon

Source: The Echinoderms of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Fun Facts

The crown-of-thorns sea star is one of the largest sea stars on the reef! It is located in especially large numbers in Australia’s Great Barrier Reef, as well as in reefs in the Red Sea and the Pacific and Indian oceans. It can grow to almost 16 inches (40cm) across, and has 12 – 19 arms, not the standard 5 arms that most starfish have. The crown-of-thorns sea star is covered with spiky spines that protect its body from predators, but even if someone did bite off one of its arms, it can re-grow it! This is something that all sea stars can do.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Aldabra, Cargados Carajos, Chagos, Eastern Africa & Madagascar, Kenya, Kermadec Islands, Madagascar, Maldives, Mascarene Basin, Mauritius, Mozambique, New Zealand Exclusive Economic Zone, Pacific Ocean, Palau Islands, Red Sea, Seychelles, South Africa, Tanzania, West Indian Ocean, Western Indian Ocean
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Acanthaster planci is found throughout the Indo-Pacific region, ranging from the Indian ocean (Red Sea and East Africa) to the Pacific (from mainland Japan south to Lord Howe Island, and from the west coast of Panama to the Gulf of California). This species is particularly common on the Great Barrier Reef of Australia.

Biogeographic Regions: nearctic (Native ); oriental (Native ); ethiopian (Native ); neotropical (Native ); australian (Native ); oceanic islands (Native ); indian ocean (Native ); pacific ocean (Native )

  • Moran, P. 1988. Crown-of-Thorns Starfish: Questions and Answers. Queensland: Australian Institute of Marine Science.
  • Moran, P. 1988. The Acanthaster phenomenon. Australian Institute of Marine Science Monograph Series, 7: 379-480.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In Panama this species occurs in the Gulf of Chiriqui but not the Gulf of Panama. It has been collected from Contreras Island (USNM E 14042, USNM E 11729; Centroid Latitude: 7.82, Centroid Longitude:-81.7750), from a depth of 2 to 8 m, and from Secas Island (USNM E 14043), from a depth of 10 m, Gulf of Chiriqui, eastern Pacific.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Coppard , Simon

Source: The Echinoderms of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Acanthaster planci bears between 8 and 21 arms that radiate from a central disc. Adults normally range from 250 to 350 mm in diameter, with some individuals over 700 mm in diameter. The mouth is located on the underside of the central disc (the aboral surface), and light-sensitive eyespots are present at the tips of the arms. Individual coloration varies from red and orange to purple, and is thought to be the result of differences in diet. The interior of the body contains the internal organs (stomach, digestive gland, and gonads). The skeletal structure is composed of tiny structures called ossicles, made of magnesium calcite. Acanthaster planci possesses large, venomous spines in contrast to the short, blunt spines usually present on starfish. The venomous quality of these spines is not fully understood; saponin has been discovered in the spines’ underlying tissue, though the quantity is not sufficient to trigger the painful reactions seen in humans who have come into contact with the spines. There is no evidence that A. planci injects toxins through the spines.

Range length: 700 (high) mm.

Other Physical Features: ectothermic ; heterothermic ; radial symmetry ; venomous

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Colour in life: deep brown above with deep red tips to spines, tube feet fawn (Humphreys, 1981). Associated with live coral beds, sometimes taking shelter under stones close to the live colonies (Sastry, 1991). Also distributed in Gilbert Islands, Tuamotus, New Caledonia (Clark, 1954); SE Arabia, W India, Pakistan, Maldive area, Ceylon, Bay of Bengal, East Indies, north Australia, Philippine, China, south Japan, South Pacific Is. and Hawaiian Is. (Clark & Rowe, 1971); Australia (Rowe & Gates, 1995); Lakshadweep (India)(Sastry, 1991). General distribution: tropical, Indo-Pacific region, depth range 0-30 m. (Rowe & Gates, 1995); East coast of Africa to Hawaiian Islands (Sastry, 1991). Ecology: benthic, reef (Rowe & Gates, 1995).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

References and links

Bell, F.J. (1909). Report on the echinodermata (other than holothurians) collected by Mr J. Stanley Gardiner in the Western parts of the Indian Ocean. Transactions of the Linnean Society Second series 13: 17-20.

Clark, A.M. (1993). An index of names of recent Asteroidea, part 2: Valvatida, in: Jangoux, M.; Lawrence, J.M. (Ed.) (1993). Echinoderm Studies, 4: pp. 187-366

Clark, A.M. and F.W.E. Rowe. (1971). Monograph of Shallow-water Indo-West Pacific Echinoderms. Trustees of the British Museum (Natural History): London.

Rowe, F.W.E & Gates, J. (1995). Zoological Catalogue of Australia 33. Echinodermata. Melbourne: CSIRO Australia, 510 pp.

C. Vogler, J. Benzie, H.A. Lessios , P. Barber and G. Wörheide. 2008. A threat to coral reefs multiplied? Four species of crown-of-thorns starfish. Biol. Lett. 4: 696-699.

Barcode of Life

Genbank

World Asteroidea Database

LSID urn:lsid:marinespecies.org:taxname:213289
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Coppard , Simon

Source: The Echinoderms of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Synonymised taxa

Acanthaster echinites (Ellis & Solander, 1786) (synonym according to Verrill (1914))
Acanthaster echinus Gervais, 1841 (Synonym according to Fisher (1919))
Acanthaster ellisi (Gray, 1840)
Acanthaster mauritiensis de Loriol, 1885 (Synonym according to Madsen (1955))
Acanthaster pseudoplanci Caso, 1962
Acanthaster solaris Schreber, 1793 (Synonym according to Madsen (1955))
Asterias echinites Ellis & Solander, 1786 (Synonym according to Verrill (1914))
Asterias echinus Verrill, 1914
Asterias planci Linnaeus, 1758
Asterias solaris Schreber, 1793 (Synonym according to Madsen (1955))
Stellonia echinites L. Agassiz, 1836 (synonym according to Verrill (1914))

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Coppard , Simon

Source: The Echinoderms of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Acanthaster planci is commonly found on coral reefs, foraging over coral colonies in shallow, protected areas of the backreef.

Average depth: 10 m.

Habitat Regions: saltwater or marine

Aquatic Biomes: benthic ; reef

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 919 specimens in 1 taxon.
Water temperature and chemistry ranges based on 902 samples.

Environmental ranges
  Depth range (m): 1 - 67
  Temperature range (°C): 23.011 - 28.954
  Nitrate (umol/L): 0.033 - 2.040
  Salinity (PPS): 32.279 - 35.483
  Oxygen (ml/l): 4.447 - 4.961
  Phosphate (umol/l): 0.067 - 0.435
  Silicate (umol/l): 0.983 - 4.452

Graphical representation

Depth range (m): 1 - 67

Temperature range (°C): 23.011 - 28.954

Nitrate (umol/L): 0.033 - 2.040

Salinity (PPS): 32.279 - 35.483

Oxygen (ml/l): 4.447 - 4.961

Phosphate (umol/l): 0.067 - 0.435

Silicate (umol/l): 0.983 - 4.452
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

While developing as larvae in the water column, individuals of this species consume smaller planktonic organisms. As an adult, this asteroid is an opportunistic carnivore, consuming sclerectinian corals, encrusting sessile invertebrates, and dead animals. It feeds by everting its stomach through its mouth onto its prey and digesting the tissues, absorbing the nutrients through the stomach wall. Acanthaster planci consumes most types of Indo-Pacific stony corals, such as Pocillopora, Acropora, Pavona, and Porites.

Animal Foods: cnidarians; other marine invertebrates

Plant Foods: algae

Primary Diet: carnivore (Eats other marine invertebrates, Scavenger ); herbivore (Algivore); detritivore

  • Keesing, J., J. Lucas. 1992. Field measurement of feeding and movement rates of the crown-of-thorns starfish Acanthaster planci (L.). J. Exp. Mar. Biol. Ecol., 156: 89–104.
  • Pratchett, M. 2007. Feeding preferences of Acanthaster planci (Echinodermata: Asteroidea) under controlled conditions of food availability. Pacific Science, 61 (1): 113-119.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

This asteroid is a corallivore, almost exclusively consuming live sclerectinian corals. An average sized adult (40 cm) can kill up to 478 square cm of live coral per day through its grazing activities. The crown-of-thorns starfish can be seen as an ongoing disturbance factor on the reef, removing swaths of clonal corals in its path, and opening up bare areas of coral rock for settlement and recruitment of other species of sessile invertebrates. Thus, A. planci can be seen to have a role in diversifying the habitat. However, if coral cover is drastically reduced, populations of coral reef specialists (animals that depend exclusively on coral cover for shelter and food) may decrease. Thus the impact of A. planci in their environment depends on how abundant they become.

Acanthaster planci harbors several genera of ectoparasitic copepod crustaceans on its dermal surface.

Commensal/Parasitic Species:

  • Glynn, P. 1976. Some physical and biological determinants of coral community structure in the Eastern Pacific. Ecological Monographs, 46 (4): 431-456.
  • Mah, C. 2010. "WoRMS Taxon Details: Acanthaster planci" (On-line). World Asteroidea database. Accessed through: World Register of Marine Species. Accessed May 24, 2011 at http://www.marinespecies.org/aphia.php?p=taxdetails&id=213289.
  • Wilson, S., S. Burgess, A. Cheal, M. Emslie, R. Fisher, I. Miller, N. Polunin, H. Sweatman. 2008. Habitat utilization by coral reef fish: Implications for specialists vs. generalists in a changing environment. Journal of Animal Ecology, 77 (2): 220-228.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

The crown-of-thorns starfish is protected from many types of predators by its long, venomous spines, though many adults (up to 60% within a population) may have missing arms, indicating that predation does occur. Juveniles assume more cryptic behaviors, inhabiting crevices and the undersides of ledges. Predators of A. planci include the giant triton shell Charonia tritonis and various fishes in the families Balistidae and Tetraodontidae, which have horny plate-like scales and strong sharp teeth that allow them to remove chunks of tissue from A. planci.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Menu

The crown-of-thorns starfish eats only one thing, and that is coral! Hunting coral using its sense of smell, it first climbs onto a coral colony and spits out its stomach onto the coral. It then covers the coral with its stomach juices, and uses tiny hairs, or cilia, to suck the meal into its body. Since it only eats other animals, it is a carnivore.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Like other asteroids, A. planci uses a combination of chemical detection and tactile senses via its tube feet to locate mates, detect its prey, and perceive its environment.

Communication Channels: tactile ; chemical

Other Communication Modes: pheromones

Perception Channels: tactile ; chemical

  • Clark, A., M. Downey. 1992. Starfishes of the Atlantic. London: Chapman & Hall.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Like most echinoderms, A. planci reproduces sexually through broadcast spawning. The female releases millions of eggs into the water column that are fertilized by a male's sperm. Fertilized eggs develop into planktonic larvae, which depend on phytoplankton for nutrition while they pass through several developmental stages, from gastrula to bipinnaria to brachiolaria. Near the end of the brachiolaria stage, the larva settles onto a suitable hard surface and metamorphoses into a juvenile starfish. Its arms will begin to develop as it matures. The juvenile starfish begins with 5 arms, which will increase to as many as 21 arms by adulthood.

Researchers note three age classes for A. planci: juvenile, sub-adult, and adult. Growth rates are age-specific: growth is rapid for juveniles (up to 16.7 mm per month) while the rate slows as they transition from sub-adult to adult (4.5 mm per month).

Development - Life Cycle: metamorphosis ; indeterminate growth

  • Engelhardt, U., M. Hartcher, J. Cruise, D. Engelhardt, M. Russell, N. Taylor, G. Thomas, D. Wiseman. 1999. Fine scale surveys of crown-of-thorns starfish (Acanthaster planci) in the central Great Barrier Reef Region. CRC Reef Research Centre Technical Report, 30: 1-97.
  • Stump, R. 1996. An investigation to describe the population dynamics of Acanthaster planci (L.) around Lizard Island, Cairns Section, Great Barrier Reef Marine Park. CRC Reef Research Technical Report, 10: 1-56.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Acanthaster planci is expected to live to about 15-17 years barring predators or limiting resources; however, the actual lifespan of this organism in the wild is unknown.

Average lifespan

Status: wild:
16 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Crown-of-thorns starfish reproduce by spawning, in which males and females release their gametes into the seawater, where fertilization occurs. Unlike some other starfish, which can reproduce through somatic fission or arm autonomy, A. planci is not known to reproduce asexually. There is evidence that A. planci releases chemicals that induces spawning in nearby individuals. However, not all individuals in a given population spawn at the same time.

When spawning, A. planci will climb to a high place on a coral outcrop, then arch its body. Gametes are released through five pores on the aboral surface of the body, as the animal waves its arms and moves its tubefeet vigorously.

Mating System: polygynandrous (promiscuous)

Acanthaster planci spawns seasonally during summer months, according to each population’s location. Populations in the northern hemisphere generally spawn between May and August, while populations in the southern hemisphere spawn between November and February. These seasons have been roughly correlated with periods of warmer water temperature in the respective habitats. Gravid females may contain anywhere from 12 to 24 million eggs, and may produce as many as 60 million eggs throughout a season.

Breeding interval: Acanthaster planci breeds once a year.

Breeding season: This species breeds in the summer months in the northern and southern hemispheres.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); broadcast (group) spawning; oviparous

As this asteroid is a broadcast spawner with a planktonic larval stage, there is no parental investment in offspring.

Parental Investment: no parental involvement

  • Birkelanci, C., J. Lucas. 1990. Acanthaster planci: Major Management Problem of Coral Reefs. Boca Raton, Florida: CRC Press.
  • Moran, P. 1988. Crown-of-Thorns Starfish: Questions and Answers. Queensland: Australian Institute of Marine Science.
  • Moran, P. 1988. The Acanthaster phenomenon. Australian Institute of Marine Science Monograph Series, 7: 379-480.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acanthaster planci

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 240 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGCAACTAAGGCGATGATTTTTTTCAACAAAACACAAGGGCATCGGGACACTATATCTAATATTTGGGGCCTGAGCAGGAATGGTTGGAACAGCCATGAGAGTAATAATACGAACAGAACTAGCCCAACCAGGCTCACTCCTCCAAGACGACCAAATATACAACGTAATAGTTACAGCTCACGCTTTAGTAATGATATTCTTCATGGTAATGCCAATTATGATCGGAGGATTCAGTAACTGACTGATCCCTCTAATGATCGGAGCACCCGATATGGCCTTCCCCCGAATGAACAACATGAGCTTTTGACTAGTACCCCCCTCTTTTCTACTACTCCTAGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACCGGATGAACCATCTACCCTCCATTATCTAGCGGCCTAGCCCACGCCGGAGGATCAGTGGACCTTGCAATATTCTCACTCCACCTTGCAGGAGCATCCTCTATCCTGGCCTCCATAAAATTCATCACTACTGTAATAAACATGCGGACCCCAGGAATCTCGTTCGACCGTCTACCACTATTCGTCTGATCAGTATTCGTAACAGCATTTCTGCTACTCCTTTCCCTTCCCGTTCTAGCTGGAGCTATAACAATGCTTCTCACCGACCGAAACGTAAACACAACCTTCTTTGACCCCGCGGGGGGAGGAGACCCTATTTTATTCCAGCACCTTTTCTGATTCTTTGGGCATCCAGAGGTGTACATTCTTATACTTCCAGGATTTGGAATGATATCCCACGTAATCGCTCACTACTCAGGTAAGAGAGAACCTTTTGGCTACCTAGGTATGGTCTACGCTATTGTGTCTATTGGGATTTTAGGGTTTCTAGTGTGAGCTCACCACATGTTTACAGTCGGTATGGACGTAGACACTCGGGCATACTTCACAGCTGCAACAATGATAATAGCCGTACCCACAGGAATCAAGGTCTTCAGGTGAATGGCAACGCTACAAGGCAGGAACCTCCGATGAGATACACCACTGCTTTGAGCCCTAGGATTTGTATTCTTATTTACCATTGGGGGACTGACAGGCGTAATCCTGGCAAAATCATCCATCGATGTCATCCTCCACGACACCTATTACGTAGTCGCCCACTTCCACTATGTCCTATCAATGGGTGCAGTGTTTGCTATTTTCGCAGGATTCACACACTGATTCCCTCTCTTTTCTGGAGTAGGACTACACCCCCTATGGGGGAAGATCCACTTCGCATTAATGTTCATAGGAGTAAACCTCACCTTTTTCCCCCAACACTTCCTAGGATTAGCAGGTATGCCACGACGATACTCCGACTACCCGGACGCCTATACCCTTTGGAATACTATCTCATCCATAGGCAGCACCATATCCCTCGTAGCAACACTGATATTCCTATTTATCATTTGGGAAGCCTTCACTTCCCAGCGAACCACTGTTCGACCCGAATTCGCACCCTCCTCACTAGAATGACAATACTCTTCCTTTCCCCCCTCCCATCACACCTTCGACGAAATTCCGGCAACCGTATACTTAATTAAGTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Acanthaster planci

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 240
Specimens with Barcodes: 245
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

This species is not listed under any conservation program.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

WhyReef - Threats

Crown-of-thorns starfish are always hungry for coral and can devour entire colonies, leaving nothing remaining but a patchy white coral skeleton. Just one of these starfish can eat 13 square miles (33.7 sq km) of coral a year! Preventing starfish feeding from causing too much damage to coral reefs is a hot topic in research today.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Much research has been conducted on the grazing effects of A. planci on coral reef cover and survival. Large populations of these starfish can devastate a reef, which has occurred on the Great Barrier Reef. Furthermore, after live coral cover has been reduced, both juvenile and sub-adult starfish preferentially choose to feed on newly-formed hard coral, which significantly impacts the coral recovery process. Surveys conducted since the early 1990’s have illustrated the decline in live hard coral cover coincident with crown-of-thorns outbreaks along the reef systems between Lizard Island and Townsville (coastal Queensland, Australia). Researchers have emphasized the importance of raising public awareness of these continually increasing outbreaks, since starfish predation on coral can seriously damage the reefs to the point where sustainability of the lucrative reef tourism industry could be impacted. To protect these reefs as well as the people who depend on them for their economic livelihood, researchers need to determine how human activities affect the cycle of starfish outbreaks. Specifically, more research needs to be conducted on the effects of overfishing known predators of A. planci, and on how increased nutrient runoff from land affects survival, recruitment, and growth of larval A. planci.

Negative Impacts: injures humans (bites or stings, venomous )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

There are no known economic benefits for humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Crown-of-thorns starfish

Acanthaster planci, commonly known as the crown-of-thorns starfish, is a large, multiple-armed starfish (or seastar) that usually preys upon hard, or stony, coral polyps (Scleractinia). The crown-of-thorns receives its name from venomous thorn-like spines that cover its upper surface or the crown of thorns of Jesus. It is one of the largest sea stars in the world, the largest being probably the sunflower seastar (Pycnopodia helianthoides).

A. planci has a very wide Indo-Pacific distribution. It occurs at tropical and subtropical latitudes from the Red Sea and the east African coast across the Pacific Ocean, across the Indian Ocean to the west coast of Central America. It occurs where coral reefs or hard coral communities occur in this region.

Contents

Physical description[edit]

Unusual brightly coloured crown-of-thorns starfish, Thailand

The body form of the crown-of-thorns starfish is fundamentally the same as that of a typical starfish. Its special traits, however, include being disc-shaped, multiple-armed, flexible, prehensile and heavily spined, and having a large ratio of stomach surface to body mass.[1] Its prehensile ability arises from the two rows of numerous tube feet that extend to the tip of each arm. In being multiple-armed, it has lost the five-fold symmetry (pentamerism) typical of starfish, although it begins with this symmetry in its life cycle.

Adult crown-of-thorns starfish normally range in size from 25 to 35 cm (9.8 to 14 in).[2] They have up to 21 arms.[3] They are usually of subdued colours, pale brown to grey-green, but they may be more brightly coloured in some parts of their wide distribution.[1]

The long, sharp spines on the sides of the starfish's arms and upper (aboral) surface resemble thorns and create a crown-like shape, giving the creature its name. The spines are stiff and very sharp, and readily pierce through soft surfaces. Despite the battery of sharp spines on the aboral surface and blunt spines on the oral surface, the crown-of-thorns starfish's general body surface is membranous and soft. When the starfish is removed from the water, the body surface ruptures and the body fluid leaks out, so the body collapses and flattens. The spines bend over and flatten as well. They recover their shape when re-immersed, if the creature is still alive.[4]

Taxonomy[edit]

Family[edit]

The family Acanthasteridae is monogeneric; its position within the Asteroides is unsettled. It is generally recognised as a distinctly isolated taxon. Recently, Blake concluded from comparative morphology studies of Acanthaster planci that it has strong similarities with various members of the Oreasteridae. He transferred Acanthasteridae from the Spinulosida to the Valvatida and assigned it a position near to the Oreasteridae, from which it appears to be derived.[5] He attributed Acanthaster morphology as possibly evolving in association with its locomotion over irregular coral surfaces in higher energy environments. There is a complication, however, in that Acanthaster in not a monospecific genus and any consideration of the genus must also take into account another species, Acanthaster brevispinus, which lives in a completely different environment. A. brevispinus lives on soft substrates, perhaps buried in the substrate at times like other soft substrate-inhabiting starfish, at moderate depths where presumably the surface is regular and there is little wave action.

Genus and species[edit]

Short-spined form from Gulf of California - live specimen

Acanthaster planci has a long history in the scientific literature with great confusion in the generic and species names from the outset, with a long list of complex synonymy.[6] As a very distinctive starfish, it is not surprising that it was first described in 1705. Rhumphius used the name Stella marina quindecium radiotorum. Later, Linnaeus described it as Asterias planci, based on an illustration by Plancus and Gualtieri (1743), when he introduced his system of binomial nomenclature. There are no known type specimens: the specimen described by Plancus and Gualtieri (1743) is not extant.

Subsequent generic names used for the crown-of-thorns starfish included Stellonia, Echinaster and Echinites before settling on Acanthaster (Gervais 1841). Species names included echintes, solaris, mauritensis, ellisii and ellisii pseudoplanci (with subspecies). Most of these names arose from confusion in the historical literature, but Acanthaster ellisii came to be used for the distinctive starfish in the eastern Pacific Gulf of California.

The eastern Pacific Acanthaster is very distinctive (see image to the right) with its rather 'plump' body, large disk to total diameter ratio and short, blunt spines. It gives the impression of living in a habitat where having sharp defenses against predators has little value, although it lives on coral reef and feeds on coral.

Genetic studies[edit]

Nishida and Lucas examined variation at 14 allozyme loci of ten population samples of A. planci using starch-gel electrophoresis. The samples were from localities across the Pacific: Ryukyu archipelago (four locations), Micronesia (two locations), and samples from one location each of the Great Barrier Reef, Fiji, Hawaii and Gulf of California. A sample of 10 specimens of A. brevispinus from the Great Barrier Reef region was included for comparison. There was considerable genetic differentiation between the A. brevispinus and A. planci populations (D= 0.20 +/- 0.02)(D is genetic distance). The genetic differences between geographic populations of A. planci were, however, small (D = 0.03 +/- 0.00; Fsr = 0.07 + 0.02) (Fsr is standardized genetic variance for each polymorphic locus) despite the great distances separating them. A positive correlation was observed between degree of genetic differentiation and geographic distance, suggesting the genetic homogeneity among A. planci populations is due to gene flow by planktonic larval dispersion. The distance effect on genetic differentiation most probably reflects decreasing levels of successful larval dispersal over long distances. In view of the level of macrogeographic homogeneity, significant allele frequency differences were observed between adjacent populations separated by approximately 10 km. The Hawaiian population was most differentiated from other populations. Treating the morphologically distinctive, eastern Pacific Acanthaster as a separate species, A. ellisii, is not supported by these data. The lack of unique alleles in the central (Hawaii) and eastern Pacific (Gulf of California) populations suggests they were derived from those in the western Pacific.

Further details of the genetic relationship between A. planci and Acanthaster brevispinus are presented in the entry for the latter species. These are clearly sibling species and it is suggested that A. planci, the specialised coral-feeding species arose from A. brevispinus, the less specialised soft-bottom inhabitant.[7]

In a very comprehensive geographic study, Benzie examined allozyme loci variation in 20 populations of A. planci, throughout the Pacific and Indian Oceans.[8] The most striking result was a very marked discontinuity between the Indian and Pacific Ocean populations. Those, however, off northern Western Australia had a strong Pacific affinity. With the exception of the very strong connection of southern Japanese populations to the Great Barrier Reef populations, the patterns of variation within regions were consistent with isolation by distance. Again, the pattern of decreasing levels of successful larval dispersal over long distances is apparent. Benzie suggests that the divergence between Indian Ocean and Pacific Ocean populations began at least 1.6 million years ago and is likely to reflect responses to changes in climate and sea level.

A more recent comprehensive geographic study of A. planci by Vogler et al., using DNA analyses (one mitochondrial gene), suggests it is actually a species complex consisting of four species or clades.[9] The four cryptic species/clades are defined geographically: northern Indian Ocean, southern Indian Ocean, Red Sea and Pacific Ocean. These molecular data suggest the species/clades diverged 1.95 and 3.65 million years ago. (The divergence of A. planci and A. brevispinus is not included in this time-scale.) The authors suggest the differences between the four putative species in behaviour, diet or habitat may be important for the design of appropriate reef conservation strategies.[10]

There are, however, problems with this proposal of cryptic speciation (cryptic species). The basis of these data from one mitochondrial gene. mtDNA data are, however, only one source of information about the status of taxa and the use of one mtDNA gene as a sole criterion for species identification is disputed.[11][12] The allozyme data should also be taken into account. Three localities that were sampled by Vogler et al. are of particular interest: Palau Sebibu, UEA and Oman were found to have two clades/sibling species in sympatry. These are important to investigate the nature of the co-existence and barriers to introgression of genetic material. A. planci as a taxon is a generalist, being amongst the most ubiquitous of large coral predators on coral reefs, feeding on virtually all hard coral species, reproducing during summer without a pattern of spawning and often participating in mass multi-species spawnings,[13] and releasing vast amounts of gametes that trigger spawning in other individuals. It is very difficult to conceive of two species/clades of A. planci in sympatry without habitat competition and introgression of genetic material, especially the latter.

Biology[edit]

Toxins[edit]

Starfish are characterised by having saponins in their tissues and these are known as 'asterosaponins'. Starfish contain a mix of these saponins and there have been at least 15 chemical studies seeking to characterise the saponins in the crown-of-thorns starfish.[1] The saponins have detergent-like properties and when the starfish are kept in limited water volumes with aeration this results in large amounts of foam at the surface.

A. planci has no mechanism for injecting the toxin, but, as the spines perforate tissue of a predator or unwary person, tissue containing the saponins is lost into the wound. In humans this immediately causes a sharp stinging pain that can last for several hours, persistent bleeding due to the haemolytic effect of saponins, and nausea and tissue swelling that may persist for a week or more.[14] The spines, which are brittle, may also break off and become embedded in the tissue where they must be removed by surgery.

It seems that saponins occur throughout the life-cycle of the crown-of-thorns starfish. There are saponins in the eggs that are similar to those in the adult tissues and presumably these carry over to the larvae.[15] The mouthing behaviour of predators to juvenile starfish with rejection suggests that the juveniles contain saponins.

Behaviour[edit]

The adult crown-of-thorns is a carnivorous predator that usually preys on reef coral polyps. It climbs onto a section of living coral colony using the large number of tube feet on its oral surface and flexible body. It fits closely to the surface of the coral, even the complex surfaces of branching corals. It then extrudes its stomach out through its mouth over the surface to virtually its own diameter. The stomach surface secretes digestive enzymes that allow the starfish to absorb nutrients from the liquefied coral tissue. This leaves a white scar of coral skeleton which is rapidly infested with filamentous algae[16] so that the original attractive reef surface is replaced by a dull surface of algae. They are voracious predators. An individual starfish can consume up to 6 square metres (65 sq ft) of living coral reef per year.[17] In a study of feeding rates on two coral reefs in the Central Great Barrier Reef region, it was found that large starfish (40 cm and greater diameter) killed approximately 161 cm²/day in winter and 357–478 cm²/day in summer. Smaller starfish 20–39 cm killed 155 and 234 cm²/day in the equivalent seasons. The area killed by the large starfish is equivalent to about 10 square metres (110 sq ft) from these observations.[18] Differences in feeding, and locomotion, rates between summer and winter reflect the fact that the crown-of-thorns like all marine invertebrates is a poikilotherm whose body temperature and metabolic rate are directly affected by the temperature of the surrounding water. In tropical coral reefs, crown-of-thorns specimens reach mean locomotion rates of 35 cm/min,[19] which explains how outbreaks can cause damage to large reef areas in relatively short periods.

The starfish show preferences between the hard corals that they feed on. They tend to feed on branching corals and table-like corals, such as Acropora species, rather than on more rounded corals with less exposed surface area, such as Porites species[20] Avoidance of Porites and some other corals may also be due to resident bivalve molluscs and polychaete worms in the surface of the coral which discourage the starfish.[21] Similarly, some symbionts, such as small crabs, living within the complex structures of branching corals may ward off the starfish as it seeks to spread its stomach over the coral surface.[22]

In reef areas of low densities of hard coral, reflecting the nature of the reef community or due to feeding by high density crown-of-thorns, the starfish may be found feeding on soft corals (Alcyonacea).[23]

The starfish are cryptic in behavior during their first two years, emerging at night to feed. They usually remain so as adults when solitary. The only evidence of a hidden individual may be white feeding scars on adjacent coral. However, their behavior changes under two circumstances:

  • During the breeding season, which is typically during early to midsummer, the starfish may gather together high on a reef and synchronously release gametes to achieve high levels of egg fertilisation[24] This pattern of synchronised spawning is not at all unique, but it is very common amongst marine invertebrates that don't copulate. Solitary spawning gives no opportunity for fertilisation of eggs and wastes gametes and there is evidence of a spawning pheromone that causes the starfish to aggregate and release gametes synchronously[25]
  • When the starfish are at high densities they may move day and night competing for living coral.

Predators[edit]

The elongated sharp spines covering nearly the entire upper surface of the crown-of-thorns serve as a mechanical defense against large predators. It also has a chemical defense. Saponins presumably serve as an irritant when the spines pierce a predator, in the same way as they do when they pierce the skin of humans. Saponins have an unpleasant taste. A study to test the predation rate on juvenile Acanthaster by appropriate fish species found that the starfish were often mouthed, tasted and rejected.[26] These defenses tend to make it an unattractive target for coral community predators. In spite of this, however, Acanthaster populations are typically composed of a proportion of individuals with regenerating arms.

A variety of about eleven species have been reported to prey occasionally on uninjured and healthy adult A. planci. All of these are generalist feeders and none of these, however, seems to specifically prefer the starfish as a food source.[27] This number, however, is probably lower as some of these presumed predators have not been witnessed reliably in the field. Some of those witnessed are:

  • A species of puffer-fish and two trigger-fish have been observed to feed on crown-of-thorns starfish in the Red Sea, and, although they may have some effect on the A. planci population, there is no evidence of systematic predation.[28]
  • The triton, a very large gastropod mollusc, is a known predator of Acanthaster in some parts of the starfish' range. The triton has been described as tearing the starfish 'to pieces with its file-like radula'.[29]
  • A small shrimp, the painted shrimp Hymenocera picta, a general predator of starfish, has been found to prey on Acanthaster planci at some locations.[30] A polychaete worm, Pherecardia striata was observed to be feeding on the starfish together with the shrimp on an east Pacific coral reef.[31] About 0.6% of the starfish in the reef population were being attacked by both the shrimp and polychaete worm, killing the starfish in about a week. Glynn suggested that this resulted in a balance between mortality and recruitment in this population, leading to a relatively stable population of starfish.[30]
  • Since Pherecardia striata can only attack a damaged A. planci and cause its death, it may be regarded as an 'impatient scavenger' rather than a predator.[32] As distinct from predators, dead and mutilated adult A. planci attract a number of scavengers. Glynn lists two polychaete worms, a hermit crab, a sea urchin and seven species of small reef fish.[31] Apparently they are able to tolerate the distasteful saponins for an easy meal.
  • A large polyp-like creature of the genus Pseudocorynactis was observed attacking, and then wholly ingesting a crown-of-thorns starfish of similar size.[33] Continued studies revealed that this polyp is able to completely ingest crown-of-thorns specimen of up to 34 cm (13 in) diameter.[34]

Life-cycle[edit]

Gametes and embryos[edit]

Gonads increase in size as the animals become sexually mature and at maturity fill the arms and extend into the disk region. The ripe ovaries and testes are readily distinguished with the former being more yellow and having larger lobes. In section they are very different with the ovaries densely filled with nutrient-packed ova (see ovum and photograph) and the testes densely filled with sperm, which consist of little more than a nucleus and flagellum. Fecundity in female Crown-of-thorns starfish is related to size with large starfish committing proportionally more energy into ova production such that a:[35]

  • 200 mm diameter female produces 0.5-2.5 million eggs representing 2-8% of its wet weight
  • 300 mm diameter female produces 6.5-14 million eggs representing 9-14% of its wet weight
  • 400 mm diameter female produces 47-53 million eggs representing 20-25% of its wet weight

In coral reefs in the Philippines, female specimens were found with a gonadosomatic index (ratio of gonad mass to body mass) as high as 22%,[36] which underlines the high fecundity of this starfish. Babcock et al. (1993)[37] monitored changes in fecundity and fertility (fertilisation rate) over the spawning season of the Crown-of-thorns starfish on Davies Reef, central Great Barrier Reef, from 1990 to 1992. The starfish were observed to spawn (photograph) from December to January (early to mid-summer) in this region with most observations being in January. However, both gonadosomatic index and fertility peaked early and declined to low levels by late January, indicating that most successful reproductive events took place early in the spawning season. In northern hemisphere coral reefs however, crown-of-thorns populations reproduce in April and May.[36] High rates of egg fertilisation may be achieved through the behaviour of proximate and synchronised spawning (see above in Behaviour).

Embryonic development begins about 1.5 hours after fertilisation, with the early cell divisions (cleavage) (photograph). By 8–9 hours it has reached the 64-cell stage.

Larval stages[edit]

By Day 1 the embryo has hatched as a ciliated gastrula stage (photograph). By Day 2 the gut is complete and the larva is now known as a bipinnaria (photographs). It has ciliated bands along the body and uses these to swim and filter feed on microscopic particles, particularly unicellular green flagellates (phytoplankton). The SEM photograph is a scanning electron micrograph, which clearly shows the complex ciliated bands of the bipinnaria larva. By Day 5 it is an early brachiolaria larva. The arms of the bipinnaria have further elongated, there are two stump-like projections in the anterior (not evident in the photograph) and structures are developing within the posterior of the larva. In the late brachiolaria larva (Day 11)(photograph) the larval arms are elongate and there are three distinctive arms at the anterior with small structures on their inner surfaces (photographs). To this stage the larva has been virtually transparent, but the posterior section is now opaque with the initial development of a starfish. The late brachiolaria is 1-1.5 mm. It tends to sink to the bottom and test the substrate with its brachiolar arms, including flexing the anterior body to orient the brachiolar arms against the substrate.

This description and assessment of optimum rate of development is based on early studies in the laboratory under attempted optimum conditions.[38][39][40] However, not unexpectedly, there are large differences in growth rate and survival under various environmental conditions (see Causes of population outbreaks).

Metamorphosis, development and growth[edit]

The late brachiolaria search substrates with their arms and, when offered a choice of substrates, tend to settle on coralline algae, which they will subsequently feed on. In the classic pattern for echinoderms, the bilaterally symmetrical larva is replaced by a pentamerously symmetrical stage at metamorphosis, with the latter's body axis bearing no relationship to that of the larva. Thus the newly metamorphosed starfish are five-armed and are 0.4–1 mm diameter. (Note the size of the tube feet relative to the size of the animal.) They feed on the thin coating layers of hard encrusting algae (coralline algae) on the undersides of dead coral rubble and other concealed surfaces. They extend their stomach over the surface of the encrusting algae and digest the tissue, as in the feeding by larger crown-of-thorns starfish on hard corals. The living tissue of the encrusting algae is approximately pink to dark red and feeding by these early juveniles results in white scars on the surface of the algae (photograph). During the next months, the juveniles grow and add arms and associated madreporites in the pattern described by Yamaguchi[41] until the adult numbers is attained 5–7 months after metamorphosis. Two hard corals with small polyps, Pocillopora damicornis and Acropora acunimata, were included in the aquaria with the encrusting algae and at about the time the juvenile starfish achieved their full number of arms they began feeding on the corals.[4]

Juvenile A. planci that had reached the stage of feeding on coral were then reared for some years in the same large closed-circuit seawater system that was used for the early juveniles. They were moved to larger tanks and kept supplied with coral so that food was not a limiting factor on growth rate. The growth curves of size versus age were sigmoidal, as seen in majority marine invertebrates.[42] There was an initial period of relatively slow growth while the starfish were feeding on coralline algae. This was followed by a phase of rapid growth which led to sexual maturity at the end of the second year. The starfish were in the vicinity of 200 mm diameter at this stage. They continued to grow rapidly and were in the order of 300 mm at 3 years of age. Then they reached a plateau between 3 and 4 years and tended to decline after 4 years. Gonad development was greater in the third and subsequent years than at 2 years and there was a seasonal pattern of gametogenesis and spawning with water temperature being the only apparent cue in the indoor aquarium. Most specimens of A. planci died from ‘senility’ during the period 5-7.5 years, i.e. they fed poorly and shrank.

Field observations of life-cycle[edit]

The data above are derived from laboratory studies of A. planci, which are much more readily obtained than equivalent data from the field. The laboratory observations, however, accord with the limited field observations of life-cycle.

As in laboratory studies where A. planci larvae were found to select coralline algae for settlement, early juveniles (<20 mm diameter) were found on subtidal coralline algae (Porolithon onkodes) on the windward reef front of Suva Reef (Fiji).[43] . The juveniles were found in a variety of habitats where they were highly concealed: under coral blocks and rubble in the boulder zone of the exposed reef front; on dead bases of Acropora species in more sheltered areas; in narrow spaces within the reef crest; and on the fore-reef slope to depths of 8 m.

Growth rates on Suva Reef were found to be 2.6, 16.7 and 5.3 mm/month increase in diameter in the pre-coral feeding, early coral feeding and adult phases, respectively.[43] This is in accord with the sigmoidal pattern of size versus age observed in laboratory studies, i.e. slow initial growth, a phase of very rapid growth beginning at coral feeding and tapering off of growth after the starfish reaches sexual maturity. In reefs in the Philippines, female and male specimens matured at 13 and 16 cm respectively.[36]

Stump[44] identified bands in the upper surface spines of A. planci and attributed these to annual growth bands. He didn't report growth rates based on these age determinations, and mark and recapture data, but he reported that the growth bands revealed 12+ year-old starfish: much older than those that became ‘senile’ and died in the laboratory.

In a small number of field studies, mortality rates of juvenile A. planci have to found to be very high, e.g. 6.5% per day for month-old and 0.45% per day for 7 month-old. Most of the mortality comes from predators, such as small crabs, that occur in and on the substrate with the juveniles.[45] It is possible, however, that these rates may not reflect mortality over the range of habitats occupied by small juveniles.

Ecology[edit]

Ecological impact on reefs[edit]

Coral before A. planci predation
Filamentous algae encrusting coral skeletons after A. planci predation
Collapsed coral skeletons after A. planci predation and storm

Popular anxiety to news of high densities of A. planci on the Great Barrier Reef was reflected in many newspaper reports and publications such as ‘Requiem for the Reef',[46] which also suggested that there was a cover-up of the extent of damage . There was a popular idea that the coral and with it whole reefs were being destroyed by the starfish. In fact, as described in section 3.2 Behaviour, the starfish preys on coral by digesting the surface of living tissue from the coral skeletons. These skeletons persist, together with the mass of coralline algae that is essential for reef integrity. The initial change (first order effect) is loss of the veneer of living coral tissue.

A. planci is a component of the fauna of most coral reefs and the effects of A. planci populations on coral reefs are very dependent on the population density. At low densities (1 to perhaps 30/hectare) the rate at which coral is being preyed upon by the starfish, is less than the growth rate of the coral, i.e. the surface area of living coral is increasing. The starfish may, however, influence the coral community structure. Because the starfish don’t feed indiscriminately they may cause a distribution of coral species and colony sizes that differs from a pattern without them. This is evident by comparison of coral reefs where A. planci hasn’t been found to the more typical reefs with A. planci.[47]

Some ecologists suggest that the starfish has an important and active role in maintaining coral reef biodiversity, driving ecological succession. Before overpopulation became a significant issue, crown-of-thorns prevented fast-growing coral from overpowering the slower growing coral varieties.[48]

At high densities (‘outbreaks’, ‘plagues’), which may be defined as when the starfish are too abundant for the coral food supply and coral cover goes into decline. The starfish must broaden their diet from their preferred species, colony size and shape. The starfish often aggregate during feeding, even at low densities, but during high densities the cleared coral patches become almost continuous or completely continuous (photograph). There are second order effects of these large areas of predated coral.

  • The bare coral skeletons are rapidly colonised by filamentous algae (photograph)
  • Large stands of staghorn coral, Acropora species, may collapse and become rubble reducing the topographical complexity of the reef (photograph)
  • Sometimes the predated surfaces are further invaded by macroalgae, soft coral and sponges. These tend to take over reef surfaces for long periods as alternatives to hard coral communities, as, once established, they limit recruitment by hard coral larvae.

Aesthetically, in all the above cases, the reef surface is not as attractive as the living coral surface, but it is anything but dead.

There is a third order effect potentially arising from the invasion by filamentous algae. Animals that depend directly or indirectly on hard corals, e.g. for shelter and food, should lose out, and herbivores and less specialist feeders gain. It would be expected that this would be most conspicuous in the fish fauna and long-terms studies of coral reef fish communities confirm this expectation.[49][50] Observations of species abundance of coral reef fish communities considered 210 fish species from 10 reefs on the Great Barrier Reef. Over a period of 11 years, major disturbances, including outbreaks of A. planci and severe storms, resulted in major declines in coral cover on all reefs. Species abundance of coral reef fishes persisted on nine of the disturbed reefs. Extensive loss of coral resulted in declines in the group of species which were heavily coral-dependent, but this loss of diversity was more than compensated for by increases in the number of species that feed on invertebrates, algae and detritus. Because of this, species abundance in coral reef fish communities was estimated to be greatest at approximately 20% coral cover. Coral loss >20%, however, typically resulted in a decline in abundance of species in coral reef fish communities. The greatest impact, however, came from severe tropical storms, that resulted in an immediate loss of topographical complexity (photograph). Fish species from all trophic levels were affected than by disturbances, such as A. planci predation, that kill corals but leave the reef framework intact.

Population outbreaks[edit]

Large populations of crown-of-thorns starfish (sometime emotively known as ‘plagues’) have been substantiated as occurring at twenty one locations of coral reefs during the 1960s to 1980s.[51] These locations ranged from the Red Sea through the tropical Indo-Pacific region to French Polynesia. There were at least two substantiated repeated outbreaks at ten of these locations.

Values of starfish density from 140/ha to 1,000/ha have been considered in various reports to be outbreak populations, while starfish densities less than 100/ha have been considered to be low;[52] however, at densities below 100/ha there may be feeding by A. planci that exceeds the growth of coral and there is net loss of coral.

From the surveys of many reef locations throughout the starfish's distribution large abundances of Acanthaster can be categorised as:

  • Primary outbreaks where there are abrupt population increases of at least two magnitudes that cannot be explained by the presence of a previous outbreak.
  • Secondary outbreaks that can plausibly be related to previous outbreaks through the reproduction of a previous cohort of the starfish. These may appear as recruits to reefs down current from an existing outbreak population.
  • Chronic situations where there is a persistent moderate to high density population at a reef location where the coral is sparse due to persistent feeding by the starfish.[53]

The Great Barrier Reef (GBR) is the most outstanding coral reef system in the world because of its great length, number of individual reefs and species diversity. When high densities of Acanthaster which were causing heavy mortality of coral were first seen about Green Island, off Cairns, in 1960-65 there was considerable alarm. High density populations were subsequently found of a number of reefs to the south of Green Island, in the Central Great Barrier Reef region[54][55][56] Some popular publications suggested that the whole Reef was in danger of dying: 'Requiem for the Reef'[57] and 'Crown of Thorns: The Death of the Barrier Reef?'.[58] They influenced and reflected some public alarm over the state and future of Great Barrier Reef.

There have been a number of studies modeling the population outbreaks on the GBR as a means to understand the phenomenon, e.g.[59][60]

The Australian and Queensland governments funded research and set up advisory committees during the period of great anxiety about the nature of the starfish outbreaks on the GBR. They were regarded as not coming to terms with the unprecedented nature and magnitude of this problem[61] and the two references above. Many scientists were criticised for not being able to give definitive but unsubstantiated answers. Others were more definitive in their answers[62] Scientists were criticised for their reticence and for disagreeing on the nature and causes of the outbreaks on the GBR, hence the publication 'Starfish Wars' (cf. 'Star Wars').[62]

Causes of population outbreaks[edit]

There was serious discussion and some strongly held views about the causes of this phenomenon. Some hypotheses focused on changes in the survival of juvenile and adult starfish - the "predator removal hypothesis":

  • over-collecting of tritons, a predator of the starfish[63]
  • overfishing of predators of the starfish[64]

Many of the reports of fish preying on "Acanthaster" are single observations or presumed predation from the nature of the fish. For example the humphead wrasse may prey on the starfish amongst its more usual diet.[66] Individual puffer fish and trigger-fish have been observed to feed crown-of-thorns starfish in the Red Sea, but there is no evidence that they are a significant factor in population control.[67] A study, however, based on the stomach contents of large carnivorous fish that are potential predators of the starfish found no evidence of the starfish in the fish's guts. These carnivorous fish were caught commercially on the coral reefs on the Gulf of Oman and examined at local fish markets.[68]

One problem with the concept of predators of large juvenile and adult starfish causing total mortality is that the starfish have good regenerative powers and they wouldn't keep still while being eaten. Also, they would need to be consumed completely or almost completely to die. In fact, 17-60% of starfish in various populations had missing or regenerating arms.[52] Clearly the starfish experience various levels of sublethal predation. When the damage includes a major section of the disk together with arms, the number of arms regenerating on the disk may be less than the number lost.[53]

Another hypothesis is the "aggregation hypothesis", whereby large aggregations of A. planci appear as apparent outbreaks because they have consumed all the adjacent coral. This seems to imply that there is apparently a dense population outbreak when there has already been a more diffuse population outbreak that has been dense enough to comprehensively prey on large areas of hard coral.

Female crown-of-thorns starfish are very fecund. Based on the eggs in ovaries, 200, 300 and 400 mm diameter females potentially spawn approximately 4, 30 and 50 million eggs, respectively[69] (see also Gametes and embryos). Lucas adopted a different approach, focusing on the survival of the larvae arising from the eggs.[70] The rationale for this approach was that small changes in the survival of larvae and developmental stages would result in very large changes in the adult population. Considering two hypothetical situations.

Twenty million eggs, from a female spawning and having a survival rate of about 0.00000001% throughout development would replace two adult starfish in a low-density population where the larvae recruit. If, however, the survival rate increases to 0.1% (one in a thousand) throughout development from one spawning of 20 million eggs this would result in 20,000 adult starfish where the larvae have recruited. Since the larvae are the most abundant stages of development it is likely that changes in survival will be most importance during this phase of development.

Temperature and salinity have little effect on the survival of crown-of-thorns larvae[71] However, abundance and species of the particular component of phytoplankton (unicellular flagellates) on which the larvae feed has a profound effect on survival and rate of growth. The abundance of phytoplankton cells is especially important.[72] As autotrophs, phytoplankton abundance is strongly influenced by the concentration of inorganic nutrients, such as nitrogenous compounds.

Birkeland had observed a correlation between the abundance of crown-of-thorns on reefs adjacent to land masses. These occurred on mainland islands as distinct from coral atolls about three years after heavy rainfall that followed a period of drought.[73] He suggested that runoff from such heavy rainfall may stimulate phytoplankton blooms of sufficient size to produce enough food for the larvae of A. planci through input of nutrients.

Combining Birkeland observations with the influence of inorganic nutrients on survival of the starfish larvae in experimental studies, gave support for a mechanism for starfish outbreaks:

increased terrestrial runoff → increased nutrients denser phytoplankton↑→ better larval survival → increased starfish populations

There have been further conformations of these connections and this is now the generally accepted mechanism for population increases of crown-of-thorns starfish.[74][75]

There is also a flow-on effect in that where there are large starfish populations producing large numbers of larvae, there is likely to be heavy recruitment on reefs downstream to which the larvae are carried and then settle.

Population control[edit]

Population numbers for the crown-of-thorns have been increasing since the 1970s.[76] However, historic records distribution patterns and numbers are hard to come by, as SCUBA technology, necessary to conduct population censuses, had only been developed in the previous few decades.

To prevent overpopulation of crown-of-thorns causing widespread destruction to coral reef habitats, humans have implemented a variety of control measures. Manual removals have been successful,[36] but are relatively labour intensive. Injecting sodium bisulphate into the starfish is the most efficient measure in practice. Sodium bisulphate is deadly to crown-of-thorns, but it does not harm the surrounding reef and oceanic ecosystems.[77] To control areas of high infestations, teams of divers have had kill rates of up to 120 per hour per diver.[77] The practice of dismembering them was shown to have a kill rate of 12 per hour per diver and the diver performing this test was spiked 3 times. Therefore, it is for this reason and not rumours that they might be able to regenerate that dismembering is not recommended.

An even more labour intensive route, but less risky to the diver, is to bury them under rocks or debris. This route is only suitable for areas with low infestation and if materials are available to perform the procedure without damaging corals.

References[edit]

  1. ^ a b c Birkeland and Lucas (1990). Acanthaster planci: major management problem of coral reefs. Florida: CRC Press. pp. 97–98. ISBN 0-8493-6599-6. 
  2. ^ Carpenter, R.C. (1997) Invertebrate Predators and Grazers" In: C. Birkeland, Life and death of coral reefs, Springer. ISBN 978-0-412-03541-8.
  3. ^ Caso, M.J. (1974). "External morphology of Acanthaster planci (Linnaeus)". Journal of the Marine Biological Associataion of India 16 (1): 83–93. 
  4. ^ a b Lucas, John; MM Jones (1976). "Hybrid crown-of-thorns starfish (Acanthaster planci x A.brevispinus) reared to maturity in the laboratory.". Nature263. 5576 (1976): 409-412. 203 (5576): 409–412, cover. 
  5. ^ Blake, DJ (1979). "The affinities and origins of the crown-of-thorns sea star Acanthaster Gervais". J. Nat. Hist. 13 (3): 303–314. 
  6. ^ Birkeland C and Lucas JS (1990). Acanthaster planci: Major Management Problem of Coral Reefs. CRC Press. pp. 13–19. 
  7. ^ Lucas, J S; Nash, W J; Nishida, M (1985). Aspects of the evolution of Acanthaster planci (L) (Echinodermata, Asteroidea). Proceedings of the fifth international coral reef congress, Tahiti 27 May - 1 June 1985, Vol. 5:. 
  8. ^ Benzie JAH (1999). "Major genetic differences between crown-of-thorns starfish (Acanthaster planci) populations in the Indian and Pacific Oceans". Evolution 53 (6): 1782–1795. 
  9. ^ Vogler C, Benzie J, Lessios H, Barber P, Wörheide G (2008-09-29). "A threat to coral reefs multiplied? Four species of crown-of-thorns starfish". Biology Letters (Royal Society) 4: 696. doi:10.1098/rsbl.2008.0454. Retrieved 2008-10-14. 
  10. ^ "Coral-killing starfish turns out to be four species, not one". Yahoo! News. AFP. 2008-09-30. Retrieved 2008-10-14. [dead link]
  11. ^ Hudson R.R. and Coyne J. (2002). "Mathematical consequences of the genealogical species concept". Evolution 56: 1557–1565. 
  12. ^ Rubinoff, D. (2006). "Utility of mitochondrial DNA barcodes in species conservation". Conserv. Biol. 20: 1026–1033. 
  13. ^ Babcock, R., Mundy, C., Keesing, J. & Oliver,J (1992). "Predictable and unpredictable spawning events: in situ behavioural data from free-spawning coral reef invertebrates.". Invertebrate Reproduction and Development 22: 213–228. 
  14. ^ Birkeland and Lucas (1990). Acanthaster planci: Major Management Problem of Coral Reefs. CRC Press. pp. 131–132. ISBN 0-8493-6599-6. 
  15. ^ Barnett, D; et al. (1968). "Determination of contents of steroidal saponins in starfish tissues and study of their biosynthesis.". Comparative Biochemistry and Physiology, B 90 (1): 141–145. 
  16. ^ Belk, D (1975). "An observation of algal colonization on Acropora aspera killed by Acanthaster planci'.". Hydrobiologia 46 (1): 29–32. 
  17. ^ Pierre Madl (1998). "Acanthaster planci (An overview of the crown of thorns starfish)". Retrieved 2006-08-28. 
  18. ^ Keesing JK; and Lucas JS (1992). "Field measurement of feeding and movement rates of the crown-of-thorns starfish Acanthaster planci (L.).". Journal of Experimental Marine Biology and Ecology 156: 89–104. 
  19. ^ Mueller B, AR Bos, G Graf and GS Gumanao (2011). "Size-specific locomotion rate and movement pattern of four common Indo-Pacific sea stars (Echinodermata; Asteroidea)". Aquatic Biology 12: 157–164. doi:10.3354/ab00326. 
  20. ^ Birkland and Lucas (1990). Acanthaster planci: Major Management Problem of Coral Reefs. CRC Press. p. 149. ISBN 0-8493-6599-6. 
  21. ^ De Vantier; Reichelt and Bradbury (1986). "Does 'Spirobranchus giganteus protect host Porites from predation by Acanthaster planci: predator pressure as a mechanism of coevolution?". Marine Ecology Progress Series 32: 307. 
  22. ^ Pratchett (2001). "Influence of coral symbionts on feeding preferences of crown-of-thorns starfish Acanthaster planci in the western Pacific.". Marine Ecology Progress Series 214: 111–119. 
  23. ^ Chansang et al., H (1987). Infestation of Acanthaster planci in the Andaman Sea. 2. Int. Symp. on Indo-Pacific Marine Biology, Agana (Guam). pp. Abstract. 
  24. ^ Babcock; Mundy and Whitehead (1994). "Sperm diffusion models and in situ confirmation of long-distance fertilization in the free-spawning asteroid Acanthaster planci". Biological Bulletin 186: 17–28. 
  25. ^ Beach, D H; Hanscomb, N J; Ormond, RFG. (1975). "Spawning pheromone in crown-of-thorns starfish". Nature 254 (5496): 135–136. 
  26. ^ Sweatman, HPA. (1995). "A field study of fish predation on juvenile crown-of-thorns starfish". Coral Reefs 14 (1): 47–53. 
  27. ^ Moran, P (1986). "The Acanthaster phenomenon". Oceanogr. Biol. Ann. Rev. 24: 379–480. 
  28. ^ Ormond, RFG; Campbell, A C. (1974). Formation and breakdown of Acanthaster planci aggregations in the Red Sea.. Proceedings of the Second International Symposium on Coral Reefs. Vol.1. 
  29. ^ Powell, G (1979). "Stars for kings". Sea Frontiers 25 (5): 282–285. 
  30. ^ a b Glynn, P (1981). Acanthaster population regulation by a shrimp and a worm. 4. International Coral Reef Symposium, Manila (Philippines), 18–22 May 1981. 
  31. ^ a b Glynn, P (1984). "An amphinomid worm predator of the crown-of-thorns sea star and general predation on asteroids in eastern and western Pacific coral reefs". Bulletin of Marine Science 35 (1): 54–71. 
  32. ^ Birkeland C and Lucas JS (1990). Acanthaster planci: Major Management Problem of Coral Reefs. CRC Press. ISBN 0-8493-6599-6. 
  33. ^ Bos AR, GS Gumanao and FN Salac (2008). "A newly discovered predator of the crown-of-thorns starfish". Coral Reefs 27: 581. doi:10.1007/s00338-008-0364-9. 
  34. ^ Bos AR, B Mueller and GS Gumanao (2011). "Feeding biology and symbiotic relationships of the Corallimorpharian Paracorynactis hoplites (Anthozoa: Hexacorallia)". The Raffles Bulletin of Zoology 59 (2): 245–250. 
  35. ^ Birkeland, C. and J.S. Lucas (1990). Acanthaster planci: Major Management Problem of Coral Reefs. Boca Raton, Florida: CRC Press. p. 63. 
  36. ^ a b c d Bos AR, GS Gumanao, B Mueller, MM Saceda-Cardoza (2012). "Management of crown-of-thorns sea star (Acanthaster planci L.) outbreaks: removal success depends on reef topography and timing within the reproduction cycle". Ocean and Coastal Management 71: 116–122. doi:10.1016/j.ocecoaman.2012.09.011. 
  37. ^ Babcock, R C; Mundy, C N; Engelhardt, U; Lassig, B. (1993). "Seasonal changes in fertility and fecundity in Acanthaster planci". Great Barrier Reef Marine Park Authority, Townsville, Qld (Australia). 
  38. ^ Henderson JA; Lucas JS (1971). "Larval development and metamorphosis of Acanthaster planci (Asteroidea).". Nature 232 (5313): 655–657. 
  39. ^ Lucas JS (1973). "Reproductive and larval biology and Acanthaster planci (L.) in Great Barrier Reef.". Micronesica 9 (2): 197–203. 
  40. ^ Yamaguchi, M. (1973). Early life histories of coral reef asteroids, with special reference to Acanthaster planci(L.). In, Biology and Geology of Coral Reefs Vol. 2. Jones, A.O. and Endean, R. (eds). Academic Press, New York. p. 369. 
  41. ^ Yamaguchi, M 1973. Early life histories of coral reef asteroids, with special reference to Acanthaster planci(L.). In, Biology and Geology of Coral Reefs Vol. 2. Jones, A.O. and Endean, R. (eds).. pp. 369. Academic Press, New York. 
  42. ^ Lucas, J S (1984). "Growth, maturation and effects of diet in Acanthaster planci (L.) (Asteroidea) and hybrids reared in the laboratory.". Journal of Experimental Marine Biology and Ecology 79: 129–147. 
  43. ^ a b Zann, L Brodie, J; Berryman, C; Naqasima, M (1987). Recruitment, ecology, growth and behavior of juvenile Acanthaster planci (L.) (Echinodermata: Asteroidea). 2nd Int. Symp. on Indo-Pacific Marine Biology, Agana (Guam), 23-28 Jun 1986. 
  44. ^ Stump, R. (1993). Life history characteristics of Acanthaster planci (L.) populations, potential clues to causes of outbreaks. Great Barrier Reef Marine Park Authority, Townsville, Qld, Australia. 
  45. ^ Keesing, J K; Halford, A R. (1992). "Field measurement of survival rates of juvenile Acanthaster planci : Techniques and preliminary results.". Marine ecology progress series 85 (1-2): 107–114. 
  46. ^ James, Peter (1876). Requiem for the Reef: The Story of Official Distortion About the Crown-of-Thorns Starfish. Brisbane: Foundation Press. 
  47. ^ Birkeland, C, Lucas, JS (1990). Acanthaster planci: Major Management Porblem of Coral Reefs. Florida: CRC Press. 
  48. ^ Larry Zetlin (2004). Predators of the Great Barrier Reef (TV-Special). Queensland, Australia: Gulliver Media Australia. 
  49. ^ Wilson, Shaun K; Graham, Nicholas AJ Pratchett, Morgan S Jones, Geoffrey P Polunin, Nicholas VC (2006). "Multiple disturbances and the global degradation of coral reefs: are reef fishes at risk or resilient?". Global Change Biology 12 (11): 2220–2234. 
  50. ^ Wilson, S K; Dolman, A M; Cheal, A J; Emslie, MJ Pratchett; et al. (2009). "Maintenance of fish diversity on disturbed coral reefs". Coral reefs 28 (1): 3–14. 
  51. ^ Birkeland and Lucas (1990). Acanthaster planci: Major Management Problem of Coral Reefs. CRC Press. pp. 36–40. ISBN 0-8493-6599-6. 
  52. ^ a b Moran, PJ (1986). "The Acanthaster phenomenon". Oceanogr. Biol. Ann. Rev., 24: 379–480. 
  53. ^ a b Birkeland and Lucas (1990). Acanthaster planci: Major Management Problem of Coral Reefs. CRC Press. p. 38. ISBN 0-8493-6599-6. 
  54. ^ Endean, R (1974). Publication title Proceedings of the Second International Symposium on Coral Reefs. Vol.1. The Great Barrier Reef Committee, Brisbane (Australia). ISBN 0-909377-00-6. 
  55. ^ Endean, R; Stablum, W (1973). "A study of some aspects of the crown-of-thorns starfish (Acanthaster planci) infestation of reefs of Australia is Great Barrier Reef.". Atoll Research Bulletin 167: 60 (Abstract). 
  56. ^ Kenchington, R (1978). "The crown-of-thorns crisis in Australia: A retrospective analysis". Environmental Conservation 5 (1): 11–20. 
  57. ^ James, Peter (1976). Requiem for the Reef. Brisbane: Foundation Press. ISBN 0-9597383-0-4. 
  58. ^ Brown, and Willey (1972). Crown of Thorns: The Death of the Great Barrier Reef?. Angus and Robertson. ISBN 0-207-12390-X. 
  59. ^ Reichelt, R E; Bradbury, R H; Moran, P J. (1990). "The crown-of-thorns starfish, Acanthaster planci , on the Great Barrier Reef.". Mathematical and Computer Modelling 13 (3): 45–60. 
  60. ^ Scandol, J P. (Dec). "CotSim--an interactive Acanthaster planci metapopulation model for the central Great Barrier Reef". Marine Models Online 1–4: 39–81. 
  61. ^ Raymond, Robert (1986). Starfish Wars: Coral Death and the Crown-of-Thorns. Melbourne: Macmillan. ISBN 0-333-43015-8. 
  62. ^ a b Endean, R; Cameron, A M (1985). Ecocatastrophe on the great Barrier Reef. Antenne Museum-EPHE, Moorea (French Polynesia): Proceedings of the fifth international coral reef congress, Tahiti 27 May - 1 June 1985, Vol. 5: Miscellaneous papers (A). pp. 309–314. 
  63. ^ Vicente, N (Dec 1999). "Natural treasures under heavy pressure". Oceanorama. Institut oceanographique Paul Ricard. Marseille 30: 7–12. 
  64. ^ Bradbury, R. (1991). "Understanding Acanthaster". Coenoses 6 (3): 121–126. 
  65. ^ Chansang et al. (1987). Infestation of Acanthaster planci in the Andaman Sea. 2. Int. Symp. on Indo-Pacific Marine Biology, Agana (Guam),. pp. Abstract only. 
  66. ^ Randall JE, SM Mead, APL Sanders (1978). "Food habits of the giant humphead wrasse Cheilinus undulatus". 
  67. ^ Ormond, RFG; Campbell, A C (1974). Formation and breakdown of Acanthaster planci aggregations in the Red Sea. Proceedings of the Second International Symposium on Coral Reefs. Vol.1. 
  68. ^ Mendonga, V M, et al. (2010). "Persistent and Expanding Population Outbreaks of the Corallivorous Starfish Acanthaster planci in the Northwestern Indian Ocean: Are They Really a Consequence of Unsustainable Starfish Predator Removal through Overfishing in Coral Reefs, or a Response to a Changing Environment?". Zoological Studies 49 (1): 108–123. 
  69. ^ Kettle, B; Lucas, JS (1987). "Biometric relationships between organ indices, fecundity, oxygen consumption and body size in Acanthaster planci (L.) (Echinodermata; Asteroidea).". Bulletin of Marine Science 41: 541–561. 
  70. ^ Henderson, JA; Lucas (1971). "Larval development and metamorphosis of Acanthaster planci (Asteroidea).". Nature 232 (5313): 655–657. 
  71. ^ Lucas, John (1973). "Reproductive and larval biology and Acanthaster planci (L.) in Great Barrier Reef.". Micronesica 9 (2): 197–203. 
  72. ^ Lucas, J (1982). "Quantitative studies of feeding and nutrition during larval development of the coral reef asteroid 'Acanthaster planci' (L.).". Journal of Experimental Marine Biology and Ecology 65 (2): 173–194. 
  73. ^ Birkeland, C (1982). "Terrestrial runoff as a cause of outbreaks of Acanthaster planci (Echinodermata: Asteroidea).". Marine biology. Berlin, Heidelberg 69 (2): 175–185. 
  74. ^ Brodie, J; Fabricius, K; De'ath, G; Okaji, K. (2005). "Are increased nutrient inputs responsible for more outbreaks of crown-of-thorns starfish? An appraisal of the evidence". Marine Pollution Bulletin 51 (1-4): 266–27. 
  75. ^ Fabricius, KE; Okaji, K; De'ath, G.. (2010). "Three lines of evidence to link outbreaks of the crown-of-thorns seastar Acanthaster planci to the release of larval food limitation". Coral reefs 29 (3): 593–605. 
  76. ^ Scientists: To save Great Barrier Reef, kill starfish. CNN News. October 2, 2012
  77. ^ a b "Controlling Crown-of Thorns Starfish". Great Barrier Reef Marine Park Authority. April 1995. Retrieved 15 December 2008. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!