Overview

Brief Summary

WhyReef - Lifestyle

The crown-of-thorns sea star is an echinoderm, which means “spiny skin.” Hiding itself in crevices in the reef during the day, this starfish likes to crawl around on the reef in huge groups of 20-200 individuals. It can move around easily using its muscular tube feet, which it also uses to collect food. At the end of each of its arms it has an eyespot. It cannot see shapes or colors with its eyespots, but it can see changes between light and dark.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description

Acanthaster planci in its current usage does not in fact refer to a single species, but a pan-Indo-Pacific species complex consisting of four deeply diverged clades (Pacific, Red Sea, Northern Indian Ocean, and Southern Indian Ocean; see Vogler et al., 2008). These clades reportedly diverged between 1.95 and 3.65 Million years ago (Pliocene to Early Pleistocene) and have genetic distances (8.8 to 10.6 %) equivalent to the distances between other sibling species of starfish (Waters et al. 2004). Vogler et al. (2008) propose that this speciation process was driven by sea level changes (Pillans et al., 1998), isolating populations.

Vogler C, Benzie J, Lessios H, Barber P, Wörheide G (2008). "A threat to coral reefs multiplied? Four species of crown-of-thorns starfish". Biology Letters (Royal Society) 4: 696.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Coppard , Simon

Source: The Echinoderms of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

WhyReef - Fun Facts

The crown-of-thorns sea star is one of the largest sea stars on the reef! It is located in especially large numbers in Australia’s Great Barrier Reef, as well as in reefs in the Red Sea and the Pacific and Indian oceans. It can grow to almost 16 inches (40cm) across, and has 12 – 19 arms, not the standard 5 arms that most starfish have. The crown-of-thorns sea star is covered with spiky spines that protect its body from predators, but even if someone did bite off one of its arms, it can re-grow it! This is something that all sea stars can do.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Acanthaster planci is found throughout the Indo-Pacific region, ranging from the Indian ocean (Red Sea and East Africa) to the Pacific (from mainland Japan south to Lord Howe Island, and from the west coast of Panama to the Gulf of California). This species is particularly common on the Great Barrier Reef of Australia.

Biogeographic Regions: nearctic (Native ); oriental (Native ); ethiopian (Native ); neotropical (Native ); australian (Native ); oceanic islands (Native ); indian ocean (Native ); pacific ocean (Native )

  • Moran, P. 1988. Crown-of-Thorns Starfish: Questions and Answers. Queensland: Australian Institute of Marine Science.
  • Moran, P. 1988. The Acanthaster phenomenon. Australian Institute of Marine Science Monograph Series, 7: 379-480.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In Panama this species occurs in the Gulf of Chiriqui but not the Gulf of Panama. It has been collected from Contreras Island (USNM E 14042, USNM E 11729; Centroid Latitude: 7.82, Centroid Longitude:-81.7750), from a depth of 2 to 8 m, and from Secas Island (USNM E 14043), from a depth of 10 m, Gulf of Chiriqui, eastern Pacific.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Coppard , Simon

Source: The Echinoderms of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Acanthaster planci bears between 8 and 21 arms that radiate from a central disc. Adults normally range from 250 to 350 mm in diameter, with some individuals over 700 mm in diameter. The mouth is located on the underside of the central disc (the aboral surface), and light-sensitive eyespots are present at the tips of the arms. Individual coloration varies from red and orange to purple, and is thought to be the result of differences in diet. The interior of the body contains the internal organs (stomach, digestive gland, and gonads). The skeletal structure is composed of tiny structures called ossicles, made of magnesium calcite. Acanthaster planci possesses large, venomous spines in contrast to the short, blunt spines usually present on starfish. The venomous quality of these spines is not fully understood; saponin has been discovered in the spines’ underlying tissue, though the quantity is not sufficient to trigger the painful reactions seen in humans who have come into contact with the spines. There is no evidence that A. planci injects toxins through the spines.

Range length: 700 (high) mm.

Other Physical Features: ectothermic ; heterothermic ; radial symmetry ; venomous

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Colour in life: deep brown above with deep red tips to spines, tube feet fawn (Humphreys, 1981). Associated with live coral beds, sometimes taking shelter under stones close to the live colonies (Sastry, 1991). Also distributed in Gilbert Islands, Tuamotus, New Caledonia (Clark, 1954); SE Arabia, W India, Pakistan, Maldive area, Ceylon, Bay of Bengal, East Indies, north Australia, Philippine, China, south Japan, South Pacific Is. and Hawaiian Is. (Clark & Rowe, 1971); Australia (Rowe & Gates, 1995); Lakshadweep (India)(Sastry, 1991). General distribution: tropical, Indo-Pacific region, depth range 0-30 m. (Rowe & Gates, 1995); East coast of Africa to Hawaiian Islands (Sastry, 1991). Ecology: benthic, reef (Rowe & Gates, 1995).
  • Clark, A.M. and F.W.E. Rowe. (1971). Monograph of Shallow-water Indo-West Pacific Echinoderms. Trustees of the British Museum (Natural History): London. x + 238 p. + 30 pls.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

References and links

Bell, F.J. (1909). Report on the echinodermata (other than holothurians) collected by Mr J. Stanley Gardiner in the Western parts of the Indian Ocean. Transactions of the Linnean Society Second series 13: 17-20.

Clark, A.M. (1993). An index of names of recent Asteroidea, part 2: Valvatida, in: Jangoux, M.; Lawrence, J.M. (Ed.) (1993). Echinoderm Studies, 4: pp. 187-366

Clark, A.M. and F.W.E. Rowe. (1971). Monograph of Shallow-water Indo-West Pacific Echinoderms. Trustees of the British Museum (Natural History): London.

Rowe, F.W.E & Gates, J. (1995). Zoological Catalogue of Australia 33. Echinodermata. Melbourne: CSIRO Australia, 510 pp.

C. Vogler, J. Benzie, H.A. Lessios , P. Barber and G. Wörheide. 2008. A threat to coral reefs multiplied? Four species of crown-of-thorns starfish. Biol. Lett. 4: 696-699.

Barcode of Life

Genbank

World Asteroidea Database

LSID urn:lsid:marinespecies.org:taxname:213289
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Coppard , Simon

Source: The Echinoderms of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Synonymised taxa

Acanthaster echinites (Ellis & Solander, 1786) (synonym according to Verrill (1914))
Acanthaster echinus Gervais, 1841 (Synonym according to Fisher (1919))
Acanthaster ellisi (Gray, 1840)
Acanthaster mauritiensis de Loriol, 1885 (Synonym according to Madsen (1955))
Acanthaster pseudoplanci Caso, 1962
Acanthaster solaris Schreber, 1793 (Synonym according to Madsen (1955))
Asterias echinites Ellis & Solander, 1786 (Synonym according to Verrill (1914))
Asterias echinus Verrill, 1914
Asterias planci Linnaeus, 1758
Asterias solaris Schreber, 1793 (Synonym according to Madsen (1955))
Stellonia echinites L. Agassiz, 1836 (synonym according to Verrill (1914))

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Coppard , Simon

Source: The Echinoderms of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Acanthaster planci is commonly found on coral reefs, foraging over coral colonies in shallow, protected areas of the backreef.

Average depth: 10 m.

Habitat Regions: saltwater or marine

Aquatic Biomes: benthic ; reef

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 919 specimens in 1 taxon.
Water temperature and chemistry ranges based on 902 samples.

Environmental ranges
  Depth range (m): 1 - 67
  Temperature range (°C): 23.011 - 28.954
  Nitrate (umol/L): 0.033 - 2.040
  Salinity (PPS): 32.279 - 35.483
  Oxygen (ml/l): 4.447 - 4.961
  Phosphate (umol/l): 0.067 - 0.435
  Silicate (umol/l): 0.983 - 4.452

Graphical representation

Depth range (m): 1 - 67

Temperature range (°C): 23.011 - 28.954

Nitrate (umol/L): 0.033 - 2.040

Salinity (PPS): 32.279 - 35.483

Oxygen (ml/l): 4.447 - 4.961

Phosphate (umol/l): 0.067 - 0.435

Silicate (umol/l): 0.983 - 4.452
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

While developing as larvae in the water column, individuals of this species consume smaller planktonic organisms. As an adult, this asteroid is an opportunistic carnivore, consuming sclerectinian corals, encrusting sessile invertebrates, and dead animals. It feeds by everting its stomach through its mouth onto its prey and digesting the tissues, absorbing the nutrients through the stomach wall. Acanthaster planci consumes most types of Indo-Pacific stony corals, such as Pocillopora, Acropora, Pavona, and Porites.

Animal Foods: cnidarians; other marine invertebrates

Plant Foods: algae

Primary Diet: carnivore (Eats other marine invertebrates, Scavenger ); herbivore (Algivore); detritivore

  • Keesing, J., J. Lucas. 1992. Field measurement of feeding and movement rates of the crown-of-thorns starfish Acanthaster planci (L.). J. Exp. Mar. Biol. Ecol., 156: 89–104.
  • Pratchett, M. 2007. Feeding preferences of Acanthaster planci (Echinodermata: Asteroidea) under controlled conditions of food availability. Pacific Science, 61 (1): 113-119.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

This asteroid is a corallivore, almost exclusively consuming live sclerectinian corals. An average sized adult (40 cm) can kill up to 478 square cm of live coral per day through its grazing activities. The crown-of-thorns starfish can be seen as an ongoing disturbance factor on the reef, removing swaths of clonal corals in its path, and opening up bare areas of coral rock for settlement and recruitment of other species of sessile invertebrates. Thus, A. planci can be seen to have a role in diversifying the habitat. However, if coral cover is drastically reduced, populations of coral reef specialists (animals that depend exclusively on coral cover for shelter and food) may decrease. Thus the impact of A. planci in their environment depends on how abundant they become.

Acanthaster planci harbors several genera of ectoparasitic copepod crustaceans on its dermal surface.

Commensal/Parasitic Species:

  • Glynn, P. 1976. Some physical and biological determinants of coral community structure in the Eastern Pacific. Ecological Monographs, 46 (4): 431-456.
  • Mah, C. 2010. "WoRMS Taxon Details: Acanthaster planci" (On-line). World Asteroidea database. Accessed through: World Register of Marine Species. Accessed May 24, 2011 at http://www.marinespecies.org/aphia.php?p=taxdetails&id=213289.
  • Wilson, S., S. Burgess, A. Cheal, M. Emslie, R. Fisher, I. Miller, N. Polunin, H. Sweatman. 2008. Habitat utilization by coral reef fish: Implications for specialists vs. generalists in a changing environment. Journal of Animal Ecology, 77 (2): 220-228.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The crown-of-thorns starfish is protected from many types of predators by its long, venomous spines, though many adults (up to 60% within a population) may have missing arms, indicating that predation does occur. Juveniles assume more cryptic behaviors, inhabiting crevices and the undersides of ledges. Predators of A. planci include the giant triton shell Charonia tritonis and various fishes in the families Balistidae and Tetraodontidae, which have horny plate-like scales and strong sharp teeth that allow them to remove chunks of tissue from A. planci.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

WhyReef - Menu

The crown-of-thorns starfish eats only one thing, and that is coral! Hunting coral using its sense of smell, it first climbs onto a coral colony and spits out its stomach onto the coral. It then covers the coral with its stomach juices, and uses tiny hairs, or cilia, to suck the meal into its body. Since it only eats other animals, it is a carnivore.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Like other asteroids, A. planci uses a combination of chemical detection and tactile senses via its tube feet to locate mates, detect its prey, and perceive its environment.

Communication Channels: tactile ; chemical

Other Communication Modes: pheromones

Perception Channels: tactile ; chemical

  • Clark, A., M. Downey. 1992. Starfishes of the Atlantic. London: Chapman & Hall.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Like most echinoderms, A. planci reproduces sexually through broadcast spawning. The female releases millions of eggs into the water column that are fertilized by a male's sperm. Fertilized eggs develop into planktonic larvae, which depend on phytoplankton for nutrition while they pass through several developmental stages, from gastrula to bipinnaria to brachiolaria. Near the end of the brachiolaria stage, the larva settles onto a suitable hard surface and metamorphoses into a juvenile starfish. Its arms will begin to develop as it matures. The juvenile starfish begins with 5 arms, which will increase to as many as 21 arms by adulthood.

Researchers note three age classes for A. planci: juvenile, sub-adult, and adult. Growth rates are age-specific: growth is rapid for juveniles (up to 16.7 mm per month) while the rate slows as they transition from sub-adult to adult (4.5 mm per month).

Development - Life Cycle: metamorphosis ; indeterminate growth

  • Engelhardt, U., M. Hartcher, J. Cruise, D. Engelhardt, M. Russell, N. Taylor, G. Thomas, D. Wiseman. 1999. Fine scale surveys of crown-of-thorns starfish (Acanthaster planci) in the central Great Barrier Reef Region. CRC Reef Research Centre Technical Report, 30: 1-97.
  • Stump, R. 1996. An investigation to describe the population dynamics of Acanthaster planci (L.) around Lizard Island, Cairns Section, Great Barrier Reef Marine Park. CRC Reef Research Technical Report, 10: 1-56.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Acanthaster planci is expected to live to about 15-17 years barring predators or limiting resources; however, the actual lifespan of this organism in the wild is unknown.

Average lifespan

Status: wild:
16 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Crown-of-thorns starfish reproduce by spawning, in which males and females release their gametes into the seawater, where fertilization occurs. Unlike some other starfish, which can reproduce through somatic fission or arm autonomy, A. planci is not known to reproduce asexually. There is evidence that A. planci releases chemicals that induces spawning in nearby individuals. However, not all individuals in a given population spawn at the same time.

When spawning, A. planci will climb to a high place on a coral outcrop, then arch its body. Gametes are released through five pores on the aboral surface of the body, as the animal waves its arms and moves its tubefeet vigorously.

Mating System: polygynandrous (promiscuous)

Acanthaster planci spawns seasonally during summer months, according to each population’s location. Populations in the northern hemisphere generally spawn between May and August, while populations in the southern hemisphere spawn between November and February. These seasons have been roughly correlated with periods of warmer water temperature in the respective habitats. Gravid females may contain anywhere from 12 to 24 million eggs, and may produce as many as 60 million eggs throughout a season.

Breeding interval: Acanthaster planci breeds once a year.

Breeding season: This species breeds in the summer months in the northern and southern hemispheres.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); broadcast (group) spawning; oviparous

As this asteroid is a broadcast spawner with a planktonic larval stage, there is no parental investment in offspring.

Parental Investment: no parental involvement

  • Birkelanci, C., J. Lucas. 1990. Acanthaster planci: Major Management Problem of Coral Reefs. Boca Raton, Florida: CRC Press.
  • Moran, P. 1988. Crown-of-Thorns Starfish: Questions and Answers. Queensland: Australian Institute of Marine Science.
  • Moran, P. 1988. The Acanthaster phenomenon. Australian Institute of Marine Science Monograph Series, 7: 379-480.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acanthaster planci

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 240 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGCAACTAAGGCGATGATTTTTTTCAACAAAACACAAGGGCATCGGGACACTATATCTAATATTTGGGGCCTGAGCAGGAATGGTTGGAACAGCCATGAGAGTAATAATACGAACAGAACTAGCCCAACCAGGCTCACTCCTCCAAGACGACCAAATATACAACGTAATAGTTACAGCTCACGCTTTAGTAATGATATTCTTCATGGTAATGCCAATTATGATCGGAGGATTCAGTAACTGACTGATCCCTCTAATGATCGGAGCACCCGATATGGCCTTCCCCCGAATGAACAACATGAGCTTTTGACTAGTACCCCCCTCTTTTCTACTACTCCTAGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACCGGATGAACCATCTACCCTCCATTATCTAGCGGCCTAGCCCACGCCGGAGGATCAGTGGACCTTGCAATATTCTCACTCCACCTTGCAGGAGCATCCTCTATCCTGGCCTCCATAAAATTCATCACTACTGTAATAAACATGCGGACCCCAGGAATCTCGTTCGACCGTCTACCACTATTCGTCTGATCAGTATTCGTAACAGCATTTCTGCTACTCCTTTCCCTTCCCGTTCTAGCTGGAGCTATAACAATGCTTCTCACCGACCGAAACGTAAACACAACCTTCTTTGACCCCGCGGGGGGAGGAGACCCTATTTTATTCCAGCACCTTTTCTGATTCTTTGGGCATCCAGAGGTGTACATTCTTATACTTCCAGGATTTGGAATGATATCCCACGTAATCGCTCACTACTCAGGTAAGAGAGAACCTTTTGGCTACCTAGGTATGGTCTACGCTATTGTGTCTATTGGGATTTTAGGGTTTCTAGTGTGAGCTCACCACATGTTTACAGTCGGTATGGACGTAGACACTCGGGCATACTTCACAGCTGCAACAATGATAATAGCCGTACCCACAGGAATCAAGGTCTTCAGGTGAATGGCAACGCTACAAGGCAGGAACCTCCGATGAGATACACCACTGCTTTGAGCCCTAGGATTTGTATTCTTATTTACCATTGGGGGACTGACAGGCGTAATCCTGGCAAAATCATCCATCGATGTCATCCTCCACGACACCTATTACGTAGTCGCCCACTTCCACTATGTCCTATCAATGGGTGCAGTGTTTGCTATTTTCGCAGGATTCACACACTGATTCCCTCTCTTTTCTGGAGTAGGACTACACCCCCTATGGGGGAAGATCCACTTCGCATTAATGTTCATAGGAGTAAACCTCACCTTTTTCCCCCAACACTTCCTAGGATTAGCAGGTATGCCACGACGATACTCCGACTACCCGGACGCCTATACCCTTTGGAATACTATCTCATCCATAGGCAGCACCATATCCCTCGTAGCAACACTGATATTCCTATTTATCATTTGGGAAGCCTTCACTTCCCAGCGAACCACTGTTCGACCCGAATTCGCACCCTCCTCACTAGAATGACAATACTCTTCCTTTCCCCCCTCCCATCACACCTTCGACGAAATTCCGGCAACCGTATACTTAATTAAGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Acanthaster planci

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 240
Specimens with Barcodes: 245
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

This species is not listed under any conservation program.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

WhyReef - Threats

Crown-of-thorns starfish are always hungry for coral and can devour entire colonies, leaving nothing remaining but a patchy white coral skeleton. Just one of these starfish can eat 13 square miles (33.7 sq km) of coral a year! Preventing starfish feeding from causing too much damage to coral reefs is a hot topic in research today.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Much research has been conducted on the grazing effects of A. planci on coral reef cover and survival. Large populations of these starfish can devastate a reef, which has occurred on the Great Barrier Reef. Furthermore, after live coral cover has been reduced, both juvenile and sub-adult starfish preferentially choose to feed on newly-formed hard coral, which significantly impacts the coral recovery process. Surveys conducted since the early 1990’s have illustrated the decline in live hard coral cover coincident with crown-of-thorns outbreaks along the reef systems between Lizard Island and Townsville (coastal Queensland, Australia). Researchers have emphasized the importance of raising public awareness of these continually increasing outbreaks, since starfish predation on coral can seriously damage the reefs to the point where sustainability of the lucrative reef tourism industry could be impacted. To protect these reefs as well as the people who depend on them for their economic livelihood, researchers need to determine how human activities affect the cycle of starfish outbreaks. Specifically, more research needs to be conducted on the effects of overfishing known predators of A. planci, and on how increased nutrient runoff from land affects survival, recruitment, and growth of larval A. planci.

Negative Impacts: injures humans (bites or stings, venomous )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

There are no known economic benefits for humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!