Overview

Brief Summary

WhyReef - Lifestyle

The crown-of-thorns sea star is an echinoderm, which means “spiny skin.” Hiding itself in crevices in the reef during the day, this starfish likes to crawl around on the reef in huge groups of 20-200 individuals. It can move around easily using its muscular tube feet, which it also uses to collect food. At the end of each of its arms it has an eyespot. It cannot see shapes or colors with its eyespots, but it can see changes between light and dark.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Acanthaster planci in its current usage does not in fact refer to a single species, but a pan-Indo-Pacific species complex consisting of four deeply diverged clades (Pacific, Red Sea, Northern Indian Ocean, and Southern Indian Ocean; see Vogler et al., 2008). These clades reportedly diverged between 1.95 and 3.65 Million years ago (Pliocene to Early Pleistocene) and have genetic distances (8.8 to 10.6 %) equivalent to the distances between other sibling species of starfish (Waters et al. 2004). Vogler et al. (2008) propose that this speciation process was driven by sea level changes (Pillans et al., 1998), isolating populations.

Vogler C, Benzie J, Lessios H, Barber P, Wörheide G (2008). "A threat to coral reefs multiplied? Four species of crown-of-thorns starfish". Biology Letters (Royal Society) 4: 696.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Coppard , Simon

Source: The Echinoderms of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Fun Facts

The crown-of-thorns sea star is one of the largest sea stars on the reef! It is located in especially large numbers in Australia’s Great Barrier Reef, as well as in reefs in the Red Sea and the Pacific and Indian oceans. It can grow to almost 16 inches (40cm) across, and has 12 – 19 arms, not the standard 5 arms that most starfish have. The crown-of-thorns sea star is covered with spiky spines that protect its body from predators, but even if someone did bite off one of its arms, it can re-grow it! This is something that all sea stars can do.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Acanthaster planci is found throughout the Indo-Pacific region, ranging from the Indian ocean (Red Sea and East Africa) to the Pacific (from mainland Japan south to Lord Howe Island, and from the west coast of Panama to the Gulf of California). This species is particularly common on the Great Barrier Reef of Australia.

Biogeographic Regions: nearctic (Native ); oriental (Native ); ethiopian (Native ); neotropical (Native ); australian (Native ); oceanic islands (Native ); indian ocean (Native ); pacific ocean (Native )

  • Moran, P. 1988. Crown-of-Thorns Starfish: Questions and Answers. Queensland: Australian Institute of Marine Science.
  • Moran, P. 1988. The Acanthaster phenomenon. Australian Institute of Marine Science Monograph Series, 7: 379-480.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Aldabra, Cargados Carajos, Chagos, Eastern Africa & Madagascar, Kenya, Kermadec Islands, Madagascar, Mascarene Basin, Mauritius, Mozambique, New Zealand Exclusive Economic Zone, Palau Islands, Red Sea, Seychelles, Tanzania, West Indian Ocean
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

In Panama this species occurs in the Gulf of Chiriqui but not the Gulf of Panama. It has been collected from Contreras Island (USNM E 14042, USNM E 11729; Centroid Latitude: 7.82, Centroid Longitude:-81.7750), from a depth of 2 to 8 m, and from Secas Island (USNM E 14043), from a depth of 10 m, Gulf of Chiriqui, eastern Pacific.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Coppard , Simon

Source: The Echinoderms of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Acanthaster planci bears between 8 and 21 arms that radiate from a central disc. Adults normally range from 250 to 350 mm in diameter, with some individuals over 700 mm in diameter. The mouth is located on the underside of the central disc (the aboral surface), and light-sensitive eyespots are present at the tips of the arms. Individual coloration varies from red and orange to purple, and is thought to be the result of differences in diet. The interior of the body contains the internal organs (stomach, digestive gland, and gonads). The skeletal structure is composed of tiny structures called ossicles, made of magnesium calcite. Acanthaster planci possesses large, venomous spines in contrast to the short, blunt spines usually present on starfish. The venomous quality of these spines is not fully understood; saponin has been discovered in the spines’ underlying tissue, though the quantity is not sufficient to trigger the painful reactions seen in humans who have come into contact with the spines. There is no evidence that A. planci injects toxins through the spines.

Range length: 700 (high) mm.

Other Physical Features: ectothermic ; heterothermic ; radial symmetry ; venomous

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Colour in life: deep brown above with deep red tips to spines, tube feet fawn (Humphreys, 1981). Associated with live coral beds, sometimes taking shelter under stones close to the live colonies (Sastry, 1991). Also distributed in Gilbert Islands, Tuamotus, New Caledonia (Clark, 1954); SE Arabia, W India, Pakistan, Maldive area, Ceylon, Bay of Bengal, East Indies, north Australia, Philippine, China, south Japan, South Pacific Is. and Hawaiian Is. (Clark & Rowe, 1971); Australia (Rowe & Gates, 1995); Lakshadweep (India)(Sastry, 1991). General distribution: tropical, Indo-Pacific region, depth range 0-30 m. (Rowe & Gates, 1995); East coast of Africa to Hawaiian Islands (Sastry, 1991). Ecology: benthic, reef (Rowe & Gates, 1995).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

References and links

Bell, F.J. (1909). Report on the echinodermata (other than holothurians) collected by Mr J. Stanley Gardiner in the Western parts of the Indian Ocean. Transactions of the Linnean Society Second series 13: 17-20.

Clark, A.M. (1993). An index of names of recent Asteroidea, part 2: Valvatida, in: Jangoux, M.; Lawrence, J.M. (Ed.) (1993). Echinoderm Studies, 4: pp. 187-366

Clark, A.M. and F.W.E. Rowe. (1971). Monograph of Shallow-water Indo-West Pacific Echinoderms. Trustees of the British Museum (Natural History): London.

Rowe, F.W.E & Gates, J. (1995). Zoological Catalogue of Australia 33. Echinodermata. Melbourne: CSIRO Australia, 510 pp.

C. Vogler, J. Benzie, H.A. Lessios , P. Barber and G. Wörheide. 2008. A threat to coral reefs multiplied? Four species of crown-of-thorns starfish. Biol. Lett. 4: 696-699.

Barcode of Life

Genbank

World Asteroidea Database

LSID urn:lsid:marinespecies.org:taxname:213289
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Coppard , Simon

Source: The Echinoderms of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Synonymised taxa

Acanthaster echinites (Ellis & Solander, 1786) (synonym according to Verrill (1914))
Acanthaster echinus Gervais, 1841 (Synonym according to Fisher (1919))
Acanthaster ellisi (Gray, 1840)
Acanthaster mauritiensis de Loriol, 1885 (Synonym according to Madsen (1955))
Acanthaster pseudoplanci Caso, 1962
Acanthaster solaris Schreber, 1793 (Synonym according to Madsen (1955))
Asterias echinites Ellis & Solander, 1786 (Synonym according to Verrill (1914))
Asterias echinus Verrill, 1914
Asterias planci Linnaeus, 1758
Asterias solaris Schreber, 1793 (Synonym according to Madsen (1955))
Stellonia echinites L. Agassiz, 1836 (synonym according to Verrill (1914))

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Coppard , Simon

Source: The Echinoderms of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

Acanthaster planci is commonly found on coral reefs, foraging over coral colonies in shallow, protected areas of the backreef.

Average depth: 10 m.

Habitat Regions: saltwater or marine

Aquatic Biomes: benthic ; reef

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 919 specimens in 1 taxon.
Water temperature and chemistry ranges based on 902 samples.

Environmental ranges
  Depth range (m): 1 - 67
  Temperature range (°C): 23.011 - 28.954
  Nitrate (umol/L): 0.033 - 2.040
  Salinity (PPS): 32.279 - 35.483
  Oxygen (ml/l): 4.447 - 4.961
  Phosphate (umol/l): 0.067 - 0.435
  Silicate (umol/l): 0.983 - 4.452

Graphical representation

Depth range (m): 1 - 67

Temperature range (°C): 23.011 - 28.954

Nitrate (umol/L): 0.033 - 2.040

Salinity (PPS): 32.279 - 35.483

Oxygen (ml/l): 4.447 - 4.961

Phosphate (umol/l): 0.067 - 0.435

Silicate (umol/l): 0.983 - 4.452
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

While developing as larvae in the water column, individuals of this species consume smaller planktonic organisms. As an adult, this asteroid is an opportunistic carnivore, consuming sclerectinian corals, encrusting sessile invertebrates, and dead animals. It feeds by everting its stomach through its mouth onto its prey and digesting the tissues, absorbing the nutrients through the stomach wall. Acanthaster planci consumes most types of Indo-Pacific stony corals, such as Pocillopora, Acropora, Pavona, and Porites.

Animal Foods: cnidarians; other marine invertebrates

Plant Foods: algae

Primary Diet: carnivore (Eats other marine invertebrates, Scavenger ); herbivore (Algivore); detritivore

  • Keesing, J., J. Lucas. 1992. Field measurement of feeding and movement rates of the crown-of-thorns starfish Acanthaster planci (L.). J. Exp. Mar. Biol. Ecol., 156: 89–104.
  • Pratchett, M. 2007. Feeding preferences of Acanthaster planci (Echinodermata: Asteroidea) under controlled conditions of food availability. Pacific Science, 61 (1): 113-119.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

This asteroid is a corallivore, almost exclusively consuming live sclerectinian corals. An average sized adult (40 cm) can kill up to 478 square cm of live coral per day through its grazing activities. The crown-of-thorns starfish can be seen as an ongoing disturbance factor on the reef, removing swaths of clonal corals in its path, and opening up bare areas of coral rock for settlement and recruitment of other species of sessile invertebrates. Thus, A. planci can be seen to have a role in diversifying the habitat. However, if coral cover is drastically reduced, populations of coral reef specialists (animals that depend exclusively on coral cover for shelter and food) may decrease. Thus the impact of A. planci in their environment depends on how abundant they become.

Acanthaster planci harbors several genera of ectoparasitic copepod crustaceans on its dermal surface.

Commensal/Parasitic Species:

  • Glynn, P. 1976. Some physical and biological determinants of coral community structure in the Eastern Pacific. Ecological Monographs, 46 (4): 431-456.
  • Mah, C. 2010. "WoRMS Taxon Details: Acanthaster planci" (On-line). World Asteroidea database. Accessed through: World Register of Marine Species. Accessed May 24, 2011 at http://www.marinespecies.org/aphia.php?p=taxdetails&id=213289.
  • Wilson, S., S. Burgess, A. Cheal, M. Emslie, R. Fisher, I. Miller, N. Polunin, H. Sweatman. 2008. Habitat utilization by coral reef fish: Implications for specialists vs. generalists in a changing environment. Journal of Animal Ecology, 77 (2): 220-228.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

The crown-of-thorns starfish is protected from many types of predators by its long, venomous spines, though many adults (up to 60% within a population) may have missing arms, indicating that predation does occur. Juveniles assume more cryptic behaviors, inhabiting crevices and the undersides of ledges. Predators of A. planci include the giant triton shell Charonia tritonis and various fishes in the families Balistidae and Tetraodontidae, which have horny plate-like scales and strong sharp teeth that allow them to remove chunks of tissue from A. planci.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Menu

The crown-of-thorns starfish eats only one thing, and that is coral! Hunting coral using its sense of smell, it first climbs onto a coral colony and spits out its stomach onto the coral. It then covers the coral with its stomach juices, and uses tiny hairs, or cilia, to suck the meal into its body. Since it only eats other animals, it is a carnivore.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Like other asteroids, A. planci uses a combination of chemical detection and tactile senses via its tube feet to locate mates, detect its prey, and perceive its environment.

Communication Channels: tactile ; chemical

Other Communication Modes: pheromones

Perception Channels: tactile ; chemical

  • Clark, A., M. Downey. 1992. Starfishes of the Atlantic. London: Chapman & Hall.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Like most echinoderms, A. planci reproduces sexually through broadcast spawning. The female releases millions of eggs into the water column that are fertilized by a male's sperm. Fertilized eggs develop into planktonic larvae, which depend on phytoplankton for nutrition while they pass through several developmental stages, from gastrula to bipinnaria to brachiolaria. Near the end of the brachiolaria stage, the larva settles onto a suitable hard surface and metamorphoses into a juvenile starfish. Its arms will begin to develop as it matures. The juvenile starfish begins with 5 arms, which will increase to as many as 21 arms by adulthood.

Researchers note three age classes for A. planci: juvenile, sub-adult, and adult. Growth rates are age-specific: growth is rapid for juveniles (up to 16.7 mm per month) while the rate slows as they transition from sub-adult to adult (4.5 mm per month).

Development - Life Cycle: metamorphosis ; indeterminate growth

  • Engelhardt, U., M. Hartcher, J. Cruise, D. Engelhardt, M. Russell, N. Taylor, G. Thomas, D. Wiseman. 1999. Fine scale surveys of crown-of-thorns starfish (Acanthaster planci) in the central Great Barrier Reef Region. CRC Reef Research Centre Technical Report, 30: 1-97.
  • Stump, R. 1996. An investigation to describe the population dynamics of Acanthaster planci (L.) around Lizard Island, Cairns Section, Great Barrier Reef Marine Park. CRC Reef Research Technical Report, 10: 1-56.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Acanthaster planci is expected to live to about 15-17 years barring predators or limiting resources; however, the actual lifespan of this organism in the wild is unknown.

Average lifespan

Status: wild:
16 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Crown-of-thorns starfish reproduce by spawning, in which males and females release their gametes into the seawater, where fertilization occurs. Unlike some other starfish, which can reproduce through somatic fission or arm autonomy, A. planci is not known to reproduce asexually. There is evidence that A. planci releases chemicals that induces spawning in nearby individuals. However, not all individuals in a given population spawn at the same time.

When spawning, A. planci will climb to a high place on a coral outcrop, then arch its body. Gametes are released through five pores on the aboral surface of the body, as the animal waves its arms and moves its tubefeet vigorously.

Mating System: polygynandrous (promiscuous)

Acanthaster planci spawns seasonally during summer months, according to each population’s location. Populations in the northern hemisphere generally spawn between May and August, while populations in the southern hemisphere spawn between November and February. These seasons have been roughly correlated with periods of warmer water temperature in the respective habitats. Gravid females may contain anywhere from 12 to 24 million eggs, and may produce as many as 60 million eggs throughout a season.

Breeding interval: Acanthaster planci breeds once a year.

Breeding season: This species breeds in the summer months in the northern and southern hemispheres.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); broadcast (group) spawning; oviparous

As this asteroid is a broadcast spawner with a planktonic larval stage, there is no parental investment in offspring.

Parental Investment: no parental involvement

  • Birkelanci, C., J. Lucas. 1990. Acanthaster planci: Major Management Problem of Coral Reefs. Boca Raton, Florida: CRC Press.
  • Moran, P. 1988. Crown-of-Thorns Starfish: Questions and Answers. Queensland: Australian Institute of Marine Science.
  • Moran, P. 1988. The Acanthaster phenomenon. Australian Institute of Marine Science Monograph Series, 7: 379-480.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acanthaster planci

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 240 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBEH0001-06|AB116377|Acanthaster planci| AGGCGATGATTTTTTTCAACAAAACACAAGGGCATCGGGACACTATATCTAATATTTGGGGCCTGAGCAGGAATGGTTGGAACAGCCATG---AGAGTAATAATACGAACAGAACTAGCCCAACCAGGCTCACTCCTCCAAGAC---GACCAAATATACAACGTAATAGTTACAGCTCACGCTTTAGTAATGATATTCTTCATGGTAATGCCAATTATGATCGGAGGATTCAGTAACTGACTGATCCCTCTAATG---ATCGGAGCACCCGATATGGCCTTCCCCCGAATGAACAACATGAGCTTTTGACTAGTACCCCCCTCTTTTCTACTACTCCTAGCATCAGCCGGAGTAGAAAGAGGCGCTGGAACCGGATGAACCATCTACCCTCCATTATCTAGCGGCCTAGCCCACGCCGGAGGATCAGTGGACCTT---GCAATATTCTCACTCCACCTTGCAGGAGCATCCTCTATCCTGGCCTCCATAAAATTCATCACTACTGTAATAAACATGCGGACCCCAGGAATCTCGTTCGACCGTCTACCACTATTCGTCTGATCAGTATTCGTAACAGCATTTCTGCTACTCCTTTCCCTTCCCGTTCTAGCTGGA---GCTATAACAATGCTTCTCACCGACCGAAACGTAAACACAACCTTCTTTGACCCCGCGGGGGGAGGAGACCCTATTTTATTCCAGCACCTTTTCTGATTCTTTGGGCATCCAGAGGTGTACATTCTTATACTTCCAGGATTTGGAATGATATCCCACGTAATCGCTCACTACTCAGGTAAGAGA---GAACCTTTTGGCTACCTAGGTATGGTCTACGCTATTGTGTCTATTGGGATTTTAGGGTTTCTAGTGTGAGCTCACCACATGTTTACAGTCGGTATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Acanthaster planci

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 240
Species: 245
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Conservation Status

This species is not listed under any conservation program.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

WhyReef - Threats

Crown-of-thorns starfish are always hungry for coral and can devour entire colonies, leaving nothing remaining but a patchy white coral skeleton. Just one of these starfish can eat 13 square miles (33.7 sq km) of coral a year! Preventing starfish feeding from causing too much damage to coral reefs is a hot topic in research today.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Much research has been conducted on the grazing effects of A. planci on coral reef cover and survival. Large populations of these starfish can devastate a reef, which has occurred on the Great Barrier Reef. Furthermore, after live coral cover has been reduced, both juvenile and sub-adult starfish preferentially choose to feed on newly-formed hard coral, which significantly impacts the coral recovery process. Surveys conducted since the early 1990’s have illustrated the decline in live hard coral cover coincident with crown-of-thorns outbreaks along the reef systems between Lizard Island and Townsville (coastal Queensland, Australia). Researchers have emphasized the importance of raising public awareness of these continually increasing outbreaks, since starfish predation on coral can seriously damage the reefs to the point where sustainability of the lucrative reef tourism industry could be impacted. To protect these reefs as well as the people who depend on them for their economic livelihood, researchers need to determine how human activities affect the cycle of starfish outbreaks. Specifically, more research needs to be conducted on the effects of overfishing known predators of A. planci, and on how increased nutrient runoff from land affects survival, recruitment, and growth of larval A. planci.

Negative Impacts: injures humans (bites or stings, venomous )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

There are no known economic benefits for humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Crown-of-thorns starfish

Acanthaster planci, commonly known as the crown-of-thorns starfish, is a large multi-armed starfish (or seastar) that usually preys upon hard,or stony, coral polyps (Scleractinia). The crown-of-thorns receives its name from poisonous thorn-like spines that cover its upper surface. It is the second largest sea star in the world. Only the sunflower seastar (Pycnopodia helianthoides) is larger.

A. plancí has a very wide Indo-Pacific distribution. It occurs at tropical and subtropical latitudes from the Red Sea and the east African coast across the Pacific Ocean, across the Indian Ocean to the west coast of Central America. It occurs where there are coral reefs or hard coral communities in this region.

Contents

Physical description

Brightly coloured Crown-of-thorns starfish, Thailand

The body form of the crown-of-thorns starfish is fundamentally the same as that of a typical starfish. Its special traits, however, include being disc-shaped, multi-armed, flexible, prehensile and heavily spined, and having a large ratio of stomach surface to body mass.[1] Its prehensile ability arises from the two rows of numerous tube feet that extend to the tip of each arm. In being multi-armed it has lost the five-fold symmetry (pentamerism) typical of starfish although it begins with this symmetry in its life cycle.

Adult crown-of-thorns starfish normally range in size from 25 to 35 cm (9.8 to 14 in).[2] They have up to 21 arms[3] They are usually of subdued colours, pale brown to grey-green, but they may be more brightly coloured in some parts of their wide distribution.[1]

The long sharp spines on the sides of the starfish's arms and upper (aboral) surface resemble thorns and create a crown-like shape, giving the creature its name. The spines are stiff and very sharp and readily pierce through soft surfaces (below). Despite the battery of sharp spines on the aboral surface and blunt spines on the oral surface, the crown-of-thorns starfish's general body surface is membranous and soft. Field collection without damaging them requires careful handling with something like a blunt rod. When the starfish are removed from the water, the body surface ruptures and the body fluid leaks out so that the body collapses and flattens. The spines bend over and flatten, and the starfish becomes a sorry sight. They recover their shape when re-immersed if not left out of water to die. Handling the starfish in an aquarium system during experiments was done carefully by hand under the oral surface[4]

Taxonomy

Family

The family Acanthasteridae is monogeneric whose position within the Asteroides is unsettled. It is generally recognised as a distinctly isolated taxon. Recently Blake concluded from comparative morphology studies of Acanthaster planci that it has strong similarities with various members of the Oreasteridae. He transferred Acanthasteridae from the Spinulosida to the Valvatida and assigned it a position near to the Oreasteridae, from which it appears to be derived[5] He attributed Acanthaster morphology as possibly evolving in association with its locomotion over irregular coral surfances in higher energy environments. There is a complication, however, in that Acanthaster in not a monospecific genus and any consideration of the genus must also take into account another species, Acanthaster brevispinus, which lives in a completely different environment. A. brevispinus lives on soft-substrates, perhaps buried in the substrate at times like other soft substrate-inhabiting starfish, at moderate depths where presumably the surface is regular and there is little wave action.

Genus and species

Short-spined form from Gulf of California

The crown-of-thorns sea star has generally been considered as a single widespread species: Acanthaster planci. However, results from DNA analyses published in September 2008 suggest that the crown-of-thorns starfish is actually constituted of four species (or subspecies – given that the genus Acanthaster is otherwise monotypic, treatment as allopatric species is preferable), with distinct distributions in the Red Sea, Pacific, Northern and Southern Indian Oceans.[6] Differences between these putative species in behaviour, diet, or habitat may be important for the design of appropriate reef conservation strategies.[7]

Acanthaster planci has a long history in the scientific literature with great confusion in the generic and species names from the outset. There is a long list of complex synonymy[8] As a very distinctive starfish, it is not surprising that it was first described in 1705. Rhumphius used the name Stella marina quindecium radiotorum. Later, Linnaeus described it as Asterias planci, baed on an illustrataion by Plancus and Gualtieri (1743), when he introduced his system of binomial nomenclature. Subsequent generic names used for the crown-of-thorns starfish included Stellonia, Echinaster and Echinites before settling on Acanthaster (Gervais 1841). Species names included echintes, solaris, mauritensis, elisii and elisii pseudoplanci (with subspecies). Most of these names arose from confusion in the historical literature, but Acanthaster elissii came to be used for the distinctive starfish in the eastern Pacific Gulf of California.

Ecology and biology

Toxins

Starfish are characterised by having saponins in their tissues and these are known as 'asterosaponins'. Starfish contain a mix of these saponins and there have been at least 15 chemical studies seeking to characterise the sapononis in the crown-of-thorns starfish.[1] A. planci has no mechanism for injecting the toxin, but, as the spines perforate tissue of a predator or unwary person, tissue containing the saponins is lost into the wound. In humans this immediately causes a sharp stinging pain that can last for several hours, persistent bleeding due to the haemolytic effect of saponins, and nausea and tissue swelling that may persist for a week or more. These are personal experiences and observations of colleagues researching the starfish over a number of years.[9] The spines, which are brittle, may also break off and become embedded in the tissue where they must be removed in a surgery.

It seems that saponins occur through the life-cycle of the crown-of-thorns starfish. There are saponins in the eggs that are similar to those in the adult tissues and presumably these carry over to the larvae[10] Mouthing behaviour of predators to juvenile starfish suggests that they contain saponins.

Behaviour

The adult crown-of-thorns is a carnivorous predator that usually preys on reef coral polyps. It climbs onto a section of living coral colony using the large number of tube feet on its oral surface and flexible body. It fits closely to the surface of the coral, even the complex surfaces of branching corals. It then extrudes its stomach out through its mouth over the surface to virtually its own diameter. The stomach surface secretes digestive enzymes that allow the starfish to absorb nutrients from the liquefied coral tissue. This leaves a white scar of coral skeleton which is rapidly infested with filamentous algae[11] so that the original attractive reef surface is replaced by a dull surface of algae. They are voracious predators. An individual starfish can consume up to 6 square metres (65 sq ft) of living coral reef per year.[12] In a study of feeding rates on two coral reefs in the Central Great Barrier Reef region, it was found that large starfish (40 cm and greater diameter) killed approximately 161 cm²/day in winter and 357–478 cm²/day in summer. Smaller starfish 20–39 cm killed 155 and 234 cm²/day in the equivalent seasons. The area killed by the large starfish is equivalent to about 10 square metres (110 sq ft) from these observations.[13] Differences in feeding, and locomotion, rates between summer and winter reflect the fact that the crown-of-thorns like all marine invertebrates is a poikilotherm whose body temperature and metabolic rate are directly affected by the temperature of the surrounding water.

The starfish show preferences between the hard corals that they feed on. They tend to feed on branching corals and table-like corals, such as Acropora species, rather than on more rounded corals with less exposed surface area, such as Porites species[14] Avoidance of Porites and some other corals may also be due to resident bivalve molluscs and polychaete worms in the surface of the coral which dicourage the starfish.[15] Similarly, some symbionts, such as small crabs, living within the complex structures of branching corals may ward off the starfish as it seeks to spread its stomach over the coralsurface.[16]

In reef areas of low densities of hard coral, reflecting the nature of the reef community or due to feeding by high density crown-of-thorns, the starfish may be found feeding on soft corals (Alcyonacea).[17]

The starfish are cryptic in behavior during their first two years, emerging at night to feed. They usually remain so as adults when solitary. The only evidence of a hidden individual may be white feeding scars on adjacent coral. However, their behavior changes under two circumstances:

  • During the breeding season, which is typically during early to midsummer, the starfish may gather together high on a reef and synchronously release gametes to achieve high levels of egg fertilisation[18] This pattern of synchronised spawning is not at all unique, but it is very common amongst marine invertebrates that don't copulate. Solitary spawning gives no opportunity for fertisation of eggs and wastes gametes and there is evidence of a spawning pheromone that causes the starfish to aggregate and release gametes synchronously[19]
  • When the starfish are at high densities they may move day and night competing for living coral.

Predators

The elongated sharp spines covering nearly the entire upper surface of the crown-of-thorns serve as a mechanical defense against large predators. It also has a chemical defense. Saponins presumably serve as an irritant when the spines pierce a predator, in the same way as they do when they pierce the skin of humans. Saponins have an unpleasant taste. A study to test the predation rate on juvenile Acanthaster by appropriate fish species found that the starfish were often mouthed, tasted and rejected.[20] These defenses tend to make it an unattractive target for coral community predators. In spite of this, however, Acanthaster populations are typically composed of a proportion of individuals with regenerating arms.

A variety of about eleven species have been reported to prey occasionally on uninjured and healthy adult A. planci. All of these are generalist feeds and none of these, however, seems to specifically prefer the starfish a food source.[21] This number, however, is probably lower as some of these presumed predators have not been witnessed reliably in the field. Some off those witnessed are:

  • A species of puffer-fish and two trigger-fish have been observed to feed on crown-of-thorns starfish in the Red Sea, and, although they may have some effect on the A. planci population, there is no evidence of systematic predation[22]
  • The triton, a very large gastropod mollusc, is a known predator of Acanthaster in some parts of the starfish' range. The triton has been described as tearing the starfish 'to pieces with its file-like radula'.[23]
  • A small shrimp, the painted shrimp Hymenocera picta, a general predator of starfish, has been found to prey on Acanthaster planci at some locations.[24] A polychaete worm, Pherecardia striata was observed to be feeding on the starfish together with the shrimp on an east Pacific coral reef[25] About 0.6% of the starfish in the reef population were being attacked by both the shrimp and polychaete worm, killing the starfish in about a week. Glynn suggested that this resulted in a balance between mortality and recruitment in this population, leading to a relatively stable population of starfish.[26]
  • Since Pherecardia striata can only attack a damaged A. planci and cause its death, it may be regarded as an 'impatient scavenger' rather than a predator[27] As distinct from predators, dead and mutilated adult A. planci attract a number of scavengers. Glynn lists two polychaete worms, a hermit crab, a sea urchin and seven species of small reef fish.[28] Apparently they are able to tolerate the distasteful saponins for an easy meal.
  • A large polyp-like creature of the genus Pseudocorynactis has been observed attacking, and then wholly ingesting a crown-of-thorns starfish of similar size.[29]

Life-cycle

Gametes and embryos

Larval stages

Metamorphosis and early juvenile development

Ecological impact

Crown-of-thorns amongst coral reef, off the coast of Madagascar

The crown-of-thorns starfish has gained notoriety as a threat to the coral reef ecosystem, particularly in the Great Barrier Reef off the coast of Australia. Overpopulation of crown-of-thorns has been blamed for widespread reef destruction. Birkeland (1985) describes the starfish as one of the most influential species in the diverse biotic communities that make up tropical coral reefs.

Some ecologists point out that the starfish has an important and active role in maintaining coral reef biodiversity, driving ecological succession. Before overpopulation became a significant issue, crown-of-thorns prevented fast-growing coral from overpowering the slower growing coral varieties.[30]

Other factors negatively affecting the reef ecosystem, such as coral bleaching or Black band disease, mean that outbreaks of the crown-of-thorns can now cause permanent and devastating damage. Increasing outbreaks are also thought to be caused by possible environmental pollution triggers. Algal blooms caused by agricultural run-off may supply predators of crown-of-thorn starfish larvae with plentiful alternative food sources. This seems the most logical explanation for the recent crown-of-thorns outbreak in the Tubbataha Reef, a UNESCO World Heritage Site.[31] These explanations may also explain why massive outbreaks seemingly appearing out of nowhere, with no previous indication of an increasing population at the affected site.[32]

The crown-of-thorns starfish may also "promote transmission" of some coral diseases.[33]

Population outbreaks

Crown-of-thorns starfish in French Polynesia

Large populations of crown-of-thorns starfish (sometime emotively known as ‘plagues’) have been substantiated as occurring at twenty one locations of coral reefs during the 1960s to 1980s.[34] These locations ranged from the Red Sea through the tropical Indoo-Pacific region to French Polynesia. There were at least two substantiated substantiated outbreaks at ten of these locations.

Values of starfish density from 140/ha to 1,000/ha have been considered in various reports to be outbreak populations, while starfish densities less than 100/ha have been considered to be low.[35] From the surveys of many reef locations throughout the starfish's distribution large abundances of Acanthaster can be categorised as:

  • Primary outbreaks where there are abrupt population increases of at least two magnitudes that cannot be explained by the presence of a previous outbreak.
  • Secondary outbreaks that can plausibly be related to previous outbreaks through the reproduction of a previous cohort of the starfish. These may appear as recruits to reefs down current from an existing outbreak population.
  • Chronic situations where there is a persistent moderate to high density population at a reef location where the coral is sparse due to persistent feeding by the starfish.[36]

The Great Barrier Reef is the most outstounding coral reef system in the world because of its great length, number of individual reefs and species diversity. When high densities of Acanthaster which were causing heavy mortality of coral were first seen about Green Island, off Cairns, in 1960-65 there was considerable alarm. High density populations were subsequently found of a number of reefs to the south of Green Island, in the Central Great Barrier Reef region[37][38][39] Some popular publications suggested that the whole Reef was in danger of dying: 'Requiem for the Reef'[40] and 'Crown of Thorns: The Death of the Barrier Reef?'.[41] They influenced and reflected some public alarm over the state and future of Great Barrier Reef.

There have been a number of studies modelling the population outbreaks on the Great Barrier Reef as a means to understand the phenomenon. These are examples[42]

The Australian and Queensland governments funded research and set up advisory committees during the period of great anxiety about the nature of the starfish outbreaks on the GBR. They were regarded as not coming to terms with the unprecedented nature and magnitude of this problem[43] and the two references above. Many scientists were criticised for not being able to give definitive but unsubstnatiated answers. Others were more definitive in their answers [44] Scientists were criticised for their reticence and for disagreeing on the nature and causes of the outbreaks on the GBR, hence the publication 'Starfish Wars' (cf. 'Star Wars').[44]

Causes of population outbreaks

There was serious discussion and some strongly held views about the causes of this phenomenon. Some hypotheses focused on changes in the survival of juvenile and adult starfish - the "predator removal hypothesis":

  • over-collecting of tritons, a predator of the starfish [45]
  • overfishing of predators of the starfish [46]

Many of the reports of fish preying on "Acanthaster" are single observations or presumed predation from the nature of the fish. For example the humphead wrasse may prey on the starfish amongst its more usual diet.[48] Individual puffer fish and trigger-fish have been observed to feed crown-of-thorns starfish in the Red Sea, but there is no evidence that they are a significant factor in population control.[49] A study, however, based on the stomach contents of large carnivorous fish that are potential predators of the starfish found no evidence of the starfish in the fish's guts. These carnivorous fish were caught commercially on the coral reefs on the Gulf of Oman and examined at local fish markets.[50]

One problem with the concept of predators of large juvenle and adult starfish causing total mortality is that the starfish have good regenerative powers and they wouldn't keep still while being eaten. Also, they would need to be consumed completely or almost completely to die. In fact, 17-60% of starfish in various populations had missing or regenerating arms.[35] Clearly the starfish experience various levels of sublethal predation. When the damage includes a major section of the disk together with arms, the number of arms regerating on the disk may be less than the number lost.[36]

Another hypothesis is the "aggregation hypothesis", whereby large aggregations of A. planci appear as apparent outbreaks because they have consumed all the adjacent coral.

Female crown-of-thorns starfish are very fecund. Based on the eggs in ovaries, 200, 300 and 400 mm diameter females potentially spawn 4, 30 and 50 million eggs, respectively[51] Lucas adopted a different approach, focusing on the survival of the larvae arising from the eggs[52] The rationale for this approach was that small changes in the survival of larvae and developmental stages would result in very large changes in the adult population. Considering two hypothetical situations.

Twenty million eggs, from a female spawning and having a survival rate of about 0.00000001% throughout development would replace two adult starfish in a low-density population where the larvae recruit. If, however, the survival rate increases to 0.1% (one in a thousand) throughout development from one spawning of 20 million eggs this would result in 20,000 adult starfish where the larvae have recruited. Since the larvae are the most abundant stages of development it is likely that changes in survival will be most importance during this phase of development.

Temperature and salinity have little affect on the survival of crown-of-thorns larvae[53] However, abundance and species of the particular component of phytoplankton (unicellular flagellates) on which the larvae feed has a profound effect on survival and rate of growth. The abundance of phytoplankton cells is especially important[54] As autotrophs, phytoplankton abundance is strongly influenced by the concentration of inorganic nutrients, such as nitrogenous compounds.

Birkeland had observed a correlation between the abundance of crown-of-thorns on reefs adjacent to land masses. These occurred on mainland islands as distinct from coral atolls about three years after heavy rainfall that followed a period of drought [55] He suggested that runoff from such heavy rainfall may stimulate phytoplankton blooms of sufficient size to produce enough food for the larvae of A. planci through input of nutrients.

Combining Birkeland observations with the influence of inorganic nutrients on survival of the starfish larvae in experimental studies, gave support for a mechanism for starfish outbreaks:

increased terrestrial runoff → increased nutrients denser phytoplankton↑→ better larval survival increased starfish populations

There have been further conformations of these connections and this is now the generally accepted mechanism for population increases of crown-of-thorns starfish.[56][57]

There is also a flow-on effect in that where there are large starfish populations producing large numbers of larvae, there is likely to be heavy recruitment on reefs downstream to which the larvae are carried and then settle.

Population control

Population numbers for the crown-of-thorns have been increasing since the 1970s.[citation needed] However, historic records distribution patterns and numbers are hard to come by, as SCUBA technology, necessary to conduct population censuses, had only been developed in the previous few decades.

To prevent overpopulation of crown-of-thorns causing widespread destruction to coral reef habitats, humans have implemented a variety of control measures.

Injecting sodium bisulphate into the starfish is the most efficient measure in practice. Sodium bisulphate is deadly to crown-of-thorns, but it does not harm the surrounding reef and oceanic ecosystems.[58] To control areas of high infestations, teams of divers have had kill rates of up to 120 per hour per diver.[58] The practice of dismembering them was shown to have a kill rate of 12 per hour per diver and the diver performing this test was spiked 3 times. Therefore, it is for this reason and not rumors that they might be able to regenerate that dismembering is not recommended.

An even more labor intensive route, but less risky to the diver, is to bury them under rocks or debris. This route is only suitable for areas with low infestation and if materials are available to perform the procedure without damaging corals.

References

  1. ^ a b c Birkeland and Lucas (1990). Acanthaster planci: major management problem of coral reefs. Florida: CRC Press. pp. 97–98. ISBN 0-8493-6599-6. 
  2. ^ Carpenter, R.C. (1997) Invertebrate Predators and Grazers" In: C. Birkeland, Life and death of coral reefs, Springer. ISBN 978-0-412-03541-8.
  3. ^ Caso, M.J. (1974). "External morphology of Acanthaster planci (Linnaeus)". Journal of the Marine Biological Associataion of India 16 (1): 83–93. 
  4. ^ Lucas, John; MM Jones (1976). "Hybrid crown-of-thorns starfish (Acanthaster planci x A. brevispinus) reared to maturity in the laboratory.". Nature263. 5576 (1976): 409-412. 203 (5576): 409–412, cover. 
  5. ^ Blake, DJ (1979). "The affinities and origins of the crown-of-thorns sea star Acanthaster Gervais". J. Nat. Hist. 13 (3): 303–314. 
  6. ^ Vogler C, Benzie J, Lessios H, Barber P, Wörheide G (2008-09-29). "A threat to coral reefs multiplied? Four species of crown-of-thorns starfish". Biology Letters (Royal Society) 4: 696. doi:10.1098/rsbl.2008.0454. http://journals.royalsociety.org/content/x87p263447251280/?p=75ccb31781484187840c4dfc8bf47f09&pi=0. Retrieved 2008-10-14. 
  7. ^ "Coral-killing starfish turns out to be four species, not one". Yahoo! News. AFP. 2008-09-30. http://news.yahoo.com/s/afp/20080930/sc_afp/environmentspeciescoralstarfish;_ylt=AlnppU0dwoo3z3CO4DxhcwgPLBIF. Retrieved 2008-10-14. [dead link]
  8. ^ Birkeland C and Lucas JS (1990). Acanthaster planci: Major Management Problem of Coral Reefs. CRC Press. pp. 13–19. 
  9. ^ Birkeland and Lucas (1990). Acanthaster planci: Major Management Problem of Coral Reefs. CRC Press. pp. 131–132. ISBN 0-8493-6599-6. 
  10. ^ Barnett, D; et al. (1968). "Determination of contents of steroidal saponins in starfish tissues and study of their biosynthesis.". Comparative Biochemistry and Physiology, B 90 (1): 141–145. 
  11. ^ Belk, D (1975). "An observation of algal colonization on Acropora aspera killed by Acanthaster planci'.". Hydrobiologia 46 (1): 29–32. 
  12. ^ Pierre Madl (1998). "Acanthaster planci (An overview of the crown of thorns starfish)". http://biophysics.sbg.ac.at/planci/planci.htm. Retrieved 2006-08-28. 
  13. ^ Keesing JK; and Lucas JS (1992). "Field measurement of feeding and movement rates of the crown-of-thorns starfish Acanthaster planci (L.).". Journal of Experimental Marine Biology and Ecology 156: 89–104. 
  14. ^ Birkland and Lucas (1990). Acanthaster planci: Major Management Problem of Coral Reefs.. CRC Press. p. 149. ISBN 0-8493-6599-6. 
  15. ^ De Vantier; Reichelt and Bradbury (1986). "Does 'Spirobranchus giganteus protect host Porites from predation by Acanthaster planci: predator pressure as a mechanism of coevolution?". Marine Ecology Progress Series 32: 307. 
  16. ^ Pratchett (2001). "Influence of coral symbionts on feeding preferences of crown-of-thorns starfish Acanthaster planci in the western Pacific.". Marine Ecology Progress Series 214: 111–119. 
  17. ^ Chansang et al., H (1987). Infestation of Acanthaster planci in the Andaman Sea.. 2. Int. Symp. on Indo-Pacific Marine Biology, Agana (Guam). pp. Abstract. 
  18. ^ Babcock; Mundy and Whitehead (1994). "Sperm diffusion models and in situ confirmation of long-distance fertilization in the free-spawning asteroid Acanthaster planci". Biological Bulletin 186: 17–28. 
  19. ^ Beach, D H; Hanscomb, N J; Ormond, RFG. (1975). "Spawning pheromone in crown-of-thorns starfish". Nature 254 (5496): 135–136. 
  20. ^ Sweatman, HPA. (1995). "A field study of fish predation on juvenile crown-of-thorns starfish". Coral Reefs 14 (1): 47–53. 
  21. ^ Moran, P (1986). "The Acanthaster phenomenon". Oceanogr. Biol. Ann. Rev. 24: 379–480. 
  22. ^ Ormond, RFG; Campbell, A C. (1974). Formation and breakdown of Acanthaster planci aggregations in the Red Sea.. Proceedings of the Second International Symposium on Coral Reefs. Vol.1.. http://search.proquest.com/docview/17931170?accountid=14723. 
  23. ^ Powell, G (1979). "Stars for kings". Sea Frontiers 25 (5): 282–285. 
  24. ^ Glynn, P (1981). Acanthaster population regulation by a shrimp and a worm. 4. International Coral Reef Symposium, Manila (Philippines), 18–22 May 1981. http://search.proquest.com/docview/13786745?accountid=14723. 
  25. ^ Glynn, P (1984). "An amphinomid worm predator of the crown-of-thorns sea star and general predation on asteroids in eastern and western Pacific coral reefs". Bulletin of Marine Science 35 (1): 54–71. 
  26. ^ Glynn, P (1981). Acanthaster population regulation by a shrimp and a worm.. 4. International Coral Reef Symposium, Manila (Philippines), 18–22 May 1981. http://search.proquest.com/docview/13786745?accountid=14723. 
  27. ^ Birkeland C and Lucas JS (1990). Acanthaster planci: Major Management Problem of Coral Reefs. CRC Press. ISBN 0-8493-6599-6. 
  28. ^ Glynn, P (1984). "An amphinomid worm predator of the crown-of-thorns sea star and general predation on asteroids in eastern and western Pacific coral reefs.". Bulletin of Marine Science 35 (1): 54–71. 
  29. ^ A.R. Bos, G.S. Gumanao & F.N. Salac (2008-02-09). "A newly discovered predator of the crown-of-thorns starfish". http://www.springerlink.com/content/b21mx171t2400680. 
  30. ^ Larry Zetlin (2004). Predators of the Great Barrier Reef (TV-Special). Queensland, Australia: Gulliver Media Australia. 
  31. ^ Arthur R. Bos (January 2010). "Crown-of-thorns Outbreak at the Tubbataha Reefs UNESCO World Heritage Site". http://zoolstud.sinica.edu.tw/Journals/49.1/124.pdf. 
  32. ^ Uthicke S, B Schaffelke and M Byrne (2009) "A boom-bust phylum?" Ecological and evolutionary consequences of density variations in echinoderms. Ecol. Monogr. 79: 3-24.
  33. ^ Nugues, M. M.; Bak, R. P. M. (2009). "Brown-band syndrome on feeding scars of the crown-of-thorn starfish Acanthaster planci". Coral Reefs 28 (2): 507. doi:10.1007/s00338-009-0468-x.  edit
  34. ^ Birkeland and Lucas (1990). Acanthaster planci: Major Management Problem of Coral Reefs. CRC Press. pp. 36–40. ISBN 0-8493-6599-6. 
  35. ^ a b Moran, PJ (1986). "The Acanthaster phenomenon". Oceanogr. Biol. Ann. Rev., 24: 379–480. 
  36. ^ a b Birkeland and Lucas (1990). Acanthaster planci: Major Management Problem of Coral Reefs. CRC Press. p. 38. ISBN 0-8493-6599-6. 
  37. ^ Endean, R (1974). Publication title Proceedings of the Second International Symposium on Coral Reefs. Vol.1.. The Great Barrier Reef Committee, Brisbane (Australia). ISBN 0-909377-00-6. 
  38. ^ Endean, R; Stablum, W (1973). "A study of some aspects of the crown-of-thorns starfish (Acanthaster planci) infestation of reefs of Australia is Great Barrier Reef.". Atoll Research Bulletin 167: 60 (Abstract). 
  39. ^ Kenchington, R (1978). "The crown-of-thorns crisis in Australia: A retrospective analysis". Environmental Conservation 5 (1): 11–20. 
  40. ^ James, Peter (1976). Requiem for the Reef. Brisbane: Foundation Press. ISBN 0-9597383-0-4. 
  41. ^ Brown, and Willey (1972). Crown of Thorns: The Death of the Great Barrier Reef?. Angus and Robertson. ISBN 0-207-12390-X. 
  42. ^ Reichelt, R E; Bradbury, R H; Moran, P J. (1990). "The crown-of-thorns starfish, Acanthaster planci , on the Great Barrier Reef.". Mathematical and Computer Modelling 13 (3): 45–60. 
  43. ^ Raymond, Robert (1986). Starfish Wars: Coral Death and the Crown-of-Thorns. Melbourne: Macmillan. ISBN 0-333-43015-8. 
  44. ^ a b Endean, R; Cameron, A M (1985). Ecocatastrophe on the great Barrier Reef.. Antenne Museum-EPHE, Moorea (French Polynesia): Proceedings of the fifth international coral reef congress, Tahiti 27 May - 1 June 1985, Vol. 5: Miscellaneous papers (A).. pp. 309–314. 
  45. ^ Vicente, N (Dec 1999). "Natural treasures under heavy pressure". Oceanorama. Institut oceanographique Paul Ricard. Marseille 30: 7–12. 
  46. ^ Bradbury, R. (1991). "Understanding Acanthaster". Coenoses 6 (3): 121–126. 
  47. ^ Chansang et al. (1987). Infestation of Acanthaster planci in the Andaman Sea.. 2. Int. Symp. on Indo-Pacific Marine Biology, Agana (Guam),. pp. Abstract only. 
  48. ^ Randall JE, SM Mead, APL Sanders (1978). "Food habits of the giant humphead wrasse Cheilinus undulatus". http://www.springerlink.com/content/u2j78566854m1364/. 
  49. ^ Ormond, RFG; Campbell, A C (1974). Formation and breakdown of Acanthaster planci aggregations in the Red Sea.. Proceedings of the Second International Symposium on Coral Reefs. Vol.1.. 
  50. ^ Mendonga, V M, et al. (2010). "Persistent and Expanding Population Outbreaks of the Corallivorous Starfish Acanthaster planci in the Northwestern Indian Ocean: Are They Really a Consequence of Unsustainable Starfish Predator Removal through Overfishing in Coral Reefs, or a Response to a Changing Environment?". Zoological Studies 49 (1): 108–123. 
  51. ^ Kettle, B; Lucas, JS (1987). "Biometric relationships between organ indices, fecundity, oxygen consumption and body size in Acanthaster planci (L.) (Echinodermata; Asteroidea).". Bulletin of Marine Science 41: 541–561. 
  52. ^ Henderson, JA; Lucas (1971). "Larval development and metamorphosis of Acanthaster planci (Asteroidea).". Nature 232 (5313): 655–657. 
  53. ^ Lucas, John (1973). "Reproductive and larval biology and Acanthaster planci (L.) in Great Barrier Reef.". Micronesica 9 (2): 197–203. 
  54. ^ Lucas, J (1982). "Quantitative studies of feeding and nutrition during larval development of the coral reef asteroid 'Acanthaster planci' (L.).". Journal of Experimental Marine Biology and Ecology 65 (2): 173–194. 
  55. ^ Birkeland, C (1982). "Terrestrial runoff as a cause of outbreaks of Acanthaster planci (Echinodermata: Asteroidea).". Marine biology. Berlin, Heidelberg 69 (2): 175–185. 
  56. ^ Brodie, J; Fabricius, K; De'ath, G; Okaji, K. (2005). "Are increased nutrient inputs responsible for more outbreaks of crown-of-thorns starfish? An appraisal of the evidence". Marine Pollution Bulletin 51 (1-4): 266-27. 
  57. ^ Fabricius, KE; Okaji, K; De'ath, G.. (2010). "Three lines of evidence to link outbreaks of the crown-of-thorns seastar Acanthaster planci to the release of larval food limitation". Coral reefs 29 (3): 593–605. 
  58. ^ a b "Controlling Crown-of Thorns Starfish". Great Barrier Reef Marine Park Authority. April 1995. http://www.reef.crc.org.au/publications/explore/feat45.html. Retrieved 15 December 2008. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!