Overview

Comprehensive Description

Biology/Natural History: Feeds on a variety of animals--bivalves, limpets, snails, brachiopods, barnacles, and tunicates. Can evert its stomach (up to a distance equal to half the length of a ray). Several limpets exhibit escape responses from this species. May have a symbiotic scaleworm (Arctonoe fragilis) living in the ambulacral groove or on the body surface (photo). In Alaska one can often find the young of the Alaska King Crab (Paralithodes camtschaticus) nestled between the rays of this seastar. Predators include gulls (especially in Alaska where they are common intertidally), Solaster dawsoni,and Pycnopodia helianthoides; and attacks by the rose star Crossaster papposus and by Alaska King Crab Paralithodes camtschaticus have been observed. Tolerant of reduced salinities down to 20 ppt.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This seastar has a small central disk and 5 long rays (total diameter is 5 to 7.6 times central disk diameter) which are not bordered by obvious marginal plates (photo). The rays usually narrow as they attach to the central disk and are widest at a point slightly out from the central disk. Exposed ossicle spines (less than 2 mm high, irregular pattern) and pedicellariae make the aboral surface rough (photo). Clusters of pedicellariae are especially visible near the ambulacral grooves, and are usually in clumps at the bases of spines. Has both crossed and straight pedicellariae. Color highly variable: gray, blue-gray, greenish, brown, orange, reddish (especially along the Oregon and California coast), pale purple; frequently margins of rays are a different shade than aboral surface. Radius up to 28 cm.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographical Range: Pribilof Islands, Alaska to Monterey Bay, CA; Kamchatka. Uncommon south of Puget Sound. This is the most abundant large, intertidal star in the Juneau area.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Look Alikes

How to Distinguish from Similar Species: Small individuals look somewhat like a Pisaster ochraceous or P. brevispinus, but this species has longer rays in proportion to its central disk and the rays narrow before they meet the central disk, and the aboral ossicles are not arranged in a clustering network.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 81 specimens in 3 taxa.
Water temperature and chemistry ranges based on 64 samples.

Environmental ranges
  Depth range (m): -2 - 149.5
  Temperature range (°C): 3.369 - 10.151
  Nitrate (umol/L): 5.320 - 27.466
  Salinity (PPS): 31.460 - 33.674
  Oxygen (ml/l): 3.031 - 7.300
  Phosphate (umol/l): 0.929 - 2.261
  Silicate (umol/l): 14.586 - 43.852

Graphical representation

Depth range (m): -2 - 149.5

Temperature range (°C): 3.369 - 10.151

Nitrate (umol/L): 5.320 - 27.466

Salinity (PPS): 31.460 - 33.674

Oxygen (ml/l): 3.031 - 7.300

Phosphate (umol/l): 0.929 - 2.261

Silicate (umol/l): 14.586 - 43.852
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth Range: Low intertidal and subtidal to 70 m. Mostly subtidal in the Rosario area (abundant in eelgrass).

Habitat: On rocks and cobbles (occasionally sand); sometimes on docks and pilings. More abundant intertidally in protected areas than along the open coast.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Evasterias troscheli

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TACTCTATATCTTATATTTGGAGCCTGAGCTGGTATGATAGGAACTGCTATGAGTGTAATAATTCGCACTGAACTTGCTCAACCCGGATCGTTACTTCAAGATGACCAAATCTATAATGTAATAGTAACTGCCCATGCCCTCGTTATGATATTTTTTATGGTGATGCCAATAATGATTGGAGGCTTTGGTAACTGATTAATACCTCTTATGATTGGGGCCCCTGATATGGCATTTCCCCGAATGAATAATATGAGATTCTGACTTATTCCTCCTTCTTTTCTACTCCTTTTAGCTTCTGCCGGAGTTGAAAGAGGAGCTGGTACAGGATGAACAATTTATCCCCCTTTGTCTAGTGGACTAGCTCACGCCGGAGGATCCGTAGATCTTGCTATTTTCTCTCTTCATCTAGCCGGAGCTTCTTCCATCCTCGCATCAATCAAATTTATTACTACTATCATAAATATGCGGACCCCAGGAATGTCCTTTGACCGACTTCCTCTATTTGTTTGATCAGTTTTCGTTACTGCTTTTTTATTGCTTCTTTCTCTTCCAGTACTAGCCGGAGCAATTACTATGCTACTCACAGACCGAAAAATTAATACCACTTTCTTTGATCCTGCCGGGGGAGGAGACCCAATTCTCTTCCAACACTTGTTTTGATTTTTTGGTCACCCTGAGGTTTATATTCTTATTTTACCTGGGTTTGGAATGATTTCTCACGTAATAGCACATTACGCGGGTAAGAACGAACCTTTTGGCTACCTAGGAATGGTTTACGCAATTATATCTATTGGAATATTAGGATTCCTTGTATGAGCCCATCACATGTTTACTGTTGGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Evasterias troscheli

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Evasterias troschelii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 61 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AGACGATGACTATTTTCTACTAAACACAAGGATATTGGTACTCTATATCTTATATTTGGAGCCTGAGCTGGTATGATAGGAACTGCTATGAGTGTAATAATTCGCACTGAACTTGCTCAACCCGGATCGTTACTTCAAGAT---GACCAAATCTATAATGTAATAGTAACTGCCCATGCCCTCGTTATGATATTTTTTATGGTGATGCCAATAATGATTGGAGGCTTTGGTAACTGATTAATACCTCTTATGATTGGGGCCCCTGATATGGCATTTCCCCGAATGAATAATATGAGATTCTGACTTATTCCTCCTTCTTTTCTACTCCTTTTAGCTTCTGCCGGAGTTGAAAGAGGAGCTGGTACAGGATGAACAATTTATCCCCCTTTGTCTAGTGGACTAGCTCACGCCGGAGGATCCGTAGATCTTGCTATTTTCTCTCTTCATCTAGCCGGAGCTTCTTCCATCCTCGCATCAATCAAATTTATTACTACTATCATAAATATGCGGACCCCAGGAATGTCCTTTGACCGACTTCCTCTATTTGTTTGATCAGTTTTCGTTACTGCTTTTTTATTGNTTCTTTCTNTTCCAGTACTAGCCGGAGCAATTACTATGCTACTCACAGACCGAAAAATTAATACCACTTTCTTTGATCCTGCCGGGGGAGGAGACCCAATTNTTTTCCAACANTTGTTTTGATTTTTTGGTCACCCTGAAGTTTATATTCTTATTTTACCTGGGTTTGGAATGATTTCTCACGTAATAGCACATTACGCGGGTAAGAACGAACCTTTTGGCTACCTAGGAATGGTTTACGCAATTATATCTATTGGAATATTAGGATTCCTTGTATGAGCCCATCACATGTTTACTGTTGGGATGGACGTAGATACCCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Evasterias troschelii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 61
Specimens with Barcodes: 61
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Evasterias troscheli

Evasterias troscheli is a species of starfish in the family Asteriidae. Its common names include the mottled star, false ochre sea star and Troschell's true star. It is found in Kamchatka and the north western coast of North America.

Contents

Description

The mottled star is a large starfish with a radius of up to 28 centimetres (11 in). It has a small disc and five long narrow arms often turned up at the tip. The widest point of the arms is a little distance away from the edge of the disc. The aboral (upper) surface of the disc is covered with a network of calcareous plates with spines about 2 mm (0.1 in) long surrounded by smaller spines and crossed and straight pedicellariae, minute pincer-like structures with 3 jaws. There is an irregular line of white-tipped spines running down the centre of the arms and the whole upper surface is rough to the touch. On the oral (lower) surface a long ambulacral groove stretches from the central mouth to the tip of each arm with four rows of tube feet and clumps of pedicellariae and spines on either side. The colour is very variable and includes plain or mottled shades of orange, brown, greenish-grey, bluish-grey and pale purple. The outer edges of the arms often have a contrasting coloured rim and the underside is pale brown.[2][3]

Distribution and habitat

The mottled star is found on the west coast of North America. Its range extends from Pribilof Islands, Alaska southwards to Monterey Bay, California but it is rarely seen south of Puget Sound. It also occurs in Kamchatka.[2] It is usually found on rocks and pebbles and occasionally on sand, at depths down to about 75 metres (246 ft). In bays and other sheltered locations it largely replaces the other common species of the area, the purple sea star (Pisaster ochraceus).[3]

Biology

The mottled star is a predator and feeds largely on bivalve molluscs. With its tube feet it can exert a powerful traction on the two valves of a mollusc shell, pulling them sufficiently far apart to insert part of its stomach through the gap. It then uses digestive enzymes to break down the mollusc's tissues before sucking them out and removing its stomach from the shell. It also consumes barnacles, chitons, gastropod molluscs, tunicates and brachiopods.[3] Some species of limpet exhibit behavioural responses to the presence of the mottled star and are able to evade it.[2]

In the north of its range, breeding takes place from April to June. Large numbers of small eggs are produced and fertilisation is external. The bipinnaria larvae that develop from these form part of the zooplankton and disperse with the currents.[3]

Ecology

The scale worm Arctonoe fragilis is often found living on the surface or in an ambulacral groove of the mottled star as a commensal.[3] The parasitic ciliate Orchitophrya stellarum has several hosts, one of which is the mottled star. It lives among the spines on the body and arms until the starfish is ready to breed when it moves inside its host, probably entering through a gonopore. It makes its way to the gonads of the male starfish and feeds on the sperm, effectively castrating its host.[4][5]

Juvenile Alaskan king crabs (Paralithodes camtschaticus) have been observed living commensally on the surface of the mottled star, sheltering between its arms.[2] Adult king crabs have been reported as attacking and eating the starfish.[3] It is also preyed on by gulls in the intertidal zone and by the morning sunstar (Solaster dawsoni) and the sunflower seastar Pycnopodia helianthoides.[2]

Petroleum hydrocarbons, such as those released as a result of the Exxon Valdez spillage, have a greater effect on the feeding and growth of the mottled star than on one of its main prey species, the mussel Mytilus edulis. Researchers surmised that pollution of the marine environment with oil might result in the domination of the mussel in the low intertidal zone of the region.[6]

References

  1. ^ a b Mah, Christopher (2010). "Evasterias troscheli (Stimpson, 1862)". World Register of Marine Species. http://www.marinespecies.org/aphia.php?p=taxdetails&id=255040. Retrieved 2012-05-18.
  2. ^ a b c d e Dave Cowles. "Evasterias troscheli (Stimpson, 1862)". Invertebrates of the Salish Sea. http://www.wallawalla.edu/academics/departments/biology/rosario/inverts/Echinodermata/Class%20Asteroidea/Evasterias_troschelii.html. Retrieved 2012-05-18.
  3. ^ a b c d e f Philip Lambert. "Evasterias troschelii (Stimpson, 1862)". Sea Stars of British Columbia, Southeast Alaska and Puget Sound. Royal BC Museum,. http://linnet.geog.ubc.ca/efauna/Atlas/Atlas.aspx?sciname=Evasterias%20troschelii. Retrieved 2012-05-18.
  4. ^ Vevers, H.G. (1951). "The biology of Asterias rubens L. II. parasitisation of the gonads by the ciliate Orchitophyra stellarum Cepede". Journal of the Marine Biological Association of the United Kingdom 29 (3): 619–625. http://sabella.mba.ac.uk/1430/01/The_biology_of_Asterias_rubens_L.__II._Parasitization_of_the_gonads_by_the_ciliate_Orchitophrya_stellarum_Cepede.pdf.
  5. ^ Burrowes, Robert B. (1936). "Further observations on parasitism in the starfish". Science 84 (2180): 329. doi:10.1126/science.84.2180.329. http://www.sciencemag.org/content/84/2180/329.citation.
  6. ^ O'Clair, C. E.; Rice, S. D. (1985). "Depression of feeding and growth rates of the seastar Evasterias troschelii during long-term exposure to the water-soluble fraction of crude oil". Marine Biology 84 (3): 331–340. doi:10.1007/BF00392503. http://www.springerlink.com/content/q422410r67g36mj6/.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!