Overview

Comprehensive Description

Biology/Natural History: This species of seastar is often considered a keystone species in many intertidal regions. P. ochraceus feeds mainly on mussels (especially Mytilus californianus and Mytilus trossulus) or will also feed on barnacles, snails, limpets, and chitons when mussels are absent. P. ochraceus will insert its stomach into snail shells or slits as narrow as 0.1 mm between the shells of bivalves. Numerous species of mollusks have avoidance responses to the Ochre Sea Star, often involving moving away. Adult ochre seastars have few predators, but may be eaten by sea otters and sea gulls. P. ochraceus is more tolerant to air exposure than others in the Pisaster genus and regularly withstands up to 8 hours exposure during low tides. It is apparently unharmed by up to 50 hours of exposure in laboratory setting; but they have an inability to tolerate high water temperatures and low oxygen levels, keeping them out of shallow bays and high tidepools (See Pincebourde et al., 2008). Sexual reproduction occurs in the late spring or in the early summer. When ready to reproduce, mature gonads may account for up to 40 percent of the animal's weight. Spawning occurs in the Puget Sound around May to July. Fertilization occurs in the sea and development results in free-swimming, plankton-feeding larvae. Embryonic development and larval feeding have been studied in detail, however little is known of juvenile life following settlement and metamorphosis. P. ochraceus has been the focus of many major studies including tests on their digestive gland tissue (which is similar to cells in the mammalian pancreas and secretes materials similar to insulin).

Pisaster ochraceous is less water permeable than some other intertidal species such as Pycnopodia helianthoides. It makes extensive use of water intake through its madreporite to maintain internal fluid balance (Ferguson, 1994). The species is still highly susceptible to osmotic changes, however. Held and Harley (2009) studied populations from high and low salinity sites. Individuals from both populations were almost complete osmoconformers over the range of 15 to 30 psu. In both populations activity (as measured by the righting response) was lowest at the lowest salinity (15 psu), and the population which had been living at lower salinity did not have any better righting response than did the one living at high salinity. The population living at high salinity, however, did experience a higher mortality after exposure to 15 psu than did the other population. Feeding rates on mussels also varied with salinity, but the maximum feeding rate in the population living at low salinity was at a lower salinity than that of the population which lived at a higher salinity.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

This species of seastar has a radius of up to about 25 cm with stout rays that taper towards the end. There are usually five rays, but occasionally as few as 4 or rarely as many as 7. The color ranges from pale orange to dark brown or deep purple (photo). The aboral surface contains many small spines (ossicles) that are arranged in a netlike or pentagonal pattern on the central disk (photo).
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Pisaster ochraceous can be found anywhere from Alaska to Baja California. It is most commonly found in the Northeastern Pacific, being that it is a cold-water species. However, it is common in bays all year.

Biogeographic Regions: pacific ocean

  • Banister, K., A. Campbell. 1985. The Encyclopedia of Aquatic Life. New York: Facts of File Publications.
  • Meinkoth, N. 1981. The Audubon Society Field Guide to North American Seashore Creatures. New York: Chanticleer Press, INC.
  • Multi-Agency Rocky Intertidal Network, 2004. "Pisaster ochraceus (Brandt, 1835): Ochre sea star" (On-line). Multi-Agency Rocky Intertidal Network. Accessed December 26, 2004 at http://www.marine.gov/pisaster.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This species has a broad distribution in the Pacific from Alaska to Panama.

In Panama this species has been collected from Taboga Island (USNM E45306), Panama Bay, Gulf of Panama, eastern Pacific, North Pacific Ocean.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Coppard , Simon

Source: The Echinoderms of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographical Range: P. ochraceus occurs from Prince William Sound in Alaska to Point Sal in Santa Barbara Co., California.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The radius of P. ochraceus is anywhere from about 10 to 18 inches (25 to 45 cm) in diameter. Yellow, orange, brown, reddish or even purple make up the ranging colors of this heavy starfish. Basically it has a good size middle disk with five stout arms sticking out. On its upper side it has short, white spines in the pentagonal pattern.

Other Physical Features: ectothermic ; heterothermic ; radial symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

References and links

Fisher, W.K. (1930). Asteroidea of the North Pacific and Adjacent Waters, Pt. 3: Forcipulata (Concluded). Bulletin of the United States National Museum 76: 1-356.Pls. 1-93.

Barcode of Life

GenBank

World Asteroidea Database

LSID urn:lsid:marinespecies.org:taxname:240755


Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Coppard , Simon

Source: The Echinoderms of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Synonymised taxa

Asteracanthion margaritifer Müller & Troschel, 1842 (Synonym according to Fisher (1930))
Asterias conferta Stimpson, 1862
Asterias fissispina Stimpson, 1862 (Synonym according to Fisher (1926, 1930))
Asterias janthina Brandt, 1835 (Synonym according to Fisher (1930))
Asterias margaritifera Brandt in Fisher, 1930 (Synonym according to Fisher (1930))
Asterias ochracea Brandt, 1835
Pisaster fissispinus (Stimpson, 1862) (Synonym according to Fisher (1926, 1930))

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Coppard , Simon

Source: The Echinoderms of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Holotype for Asterias fissispina Stimpson, 1862
Catalog Number: USNM 1276
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Collector(s): J. Cooper
Locality: Cape Shoalwater, Washington, United States, North Pacific Ocean
  • Holotype: Stimpson. 1862. Proc. Boston Soc. nat. Hist. 8: 264.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Holotype for Asterias conferta Stimpson, 1862
Catalog Number: USNM 1275
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Collector(s): C. Kennerly
Locality: Puget Sound, Washington, United States, North Pacific Ocean
  • Holotype: Stimpson. 1862. Proc. Boston Soc. nat. Hist. 8: 263-264.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

How to Distinguish from Similar Species: Troschel’s Sea Star (Evasterias troschelii) may be confused with P. ochraceus at times. E. troschelii is distinguished from P. ochraceus by the smaller disk size and longer, tapering rays which are often thickest a short distance out from the base rather than at the base as in P. ochraceus; clusters of pedicellariae among the spines that border the ambulacral grooves, and the absence of a stellate pattern of spines on the aboral surface of the disk. There are two other, mostly subtidal, local species of Pisaster (Pisaster giganteus and Pisaster brevispinus) but they have different aboral spines and coloration which allows one to distinguish between the species.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Pisaster ochraceous can be found on wave-washed rocky shores, from above the low-tide zone to 90 m in depth. Because they can live in shallow water they need to survive in these living conditions, including strong surges, big temperature changes, dilution by rainfall, and dessication. Pisaster ochraceous is very resistant to dessication and it can tolerate a loss of thirty-percent of its body weight in body fluids.

Range depth: 90 (high) m.

Habitat Regions: temperate ; saltwater or marine

Aquatic Biomes: coastal

Other Habitat Features: intertidal or littoral

  • Grzimeck, B. 1972. Grzimeck's Animal Life Encyclopedia Volume 3 Mollusks and Echnoderms. New York, Cincinnati, Chicago: Van Nostrand Reinhold Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 98 specimens in 2 taxa.
Water temperature and chemistry ranges based on 82 samples.

Environmental ranges
  Depth range (m): -2 - 88
  Temperature range (°C): 8.675 - 10.345
  Nitrate (umol/L): 5.634 - 9.754
  Salinity (PPS): 31.235 - 32.028
  Oxygen (ml/l): 6.360 - 6.794
  Phosphate (umol/l): 0.883 - 1.305
  Silicate (umol/l): 12.975 - 25.127

Graphical representation

Depth range (m): -2 - 88

Temperature range (°C): 8.675 - 10.345

Nitrate (umol/L): 5.634 - 9.754

Salinity (PPS): 31.235 - 32.028

Oxygen (ml/l): 6.360 - 6.794

Phosphate (umol/l): 0.883 - 1.305

Silicate (umol/l): 12.975 - 25.127
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth Range: P. ochraceus occurs in the low and middle intertidal zones, and sometimes in the subtidal zone (to 88 m).

Habitat: This organism occurs on wave-washed rocky shores. The juveniles are often found in crevices and under rocks.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

At the larval stage, Pisaster ochraceus are filter feeders, eating plankton.

Like all sea stars, an adult P. ochraceus has tube feet which they use for locomotion and for handling prey. Pisaster ochraceous feeds on mussels, chitons, and limpets, which they slowly pry open and devour. Snails, barnacles, echinoids, even decapod crustacea are also eaten. Pisaster ochraceous everts its stomach over the prey if it is too large to be swallowed whole, and digests the prey before swallowing it.

Animal Foods: mollusks; aquatic crustaceans; echinoderms; other marine invertebrates; zooplankton

Plant Foods: phytoplankton

Foraging Behavior: filter-feeding

Primary Diet: carnivore (Eats non-insect arthropods, Molluscivore , Eats other marine invertebrates); planktivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Pisaster ochraceous is a predator and is a prey to sea otters and sea gulls. Its role as a keystone species has been well studied. In intertidal areas of Washington, when it was removed, the diversity of species in the area decreased.

Ecosystem Impact: keystone species

  • Paine, R., S. Levin. 1981. Intertidal landscapes: disturbance and the dynamics of pattern. Ecological monographs, 51: 145-178.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Sea otters and gulls prey on this starfish. Pisaster ochraceus can retract such sensitive areas as the podia and skin papillae. Additionally, they may be able to shut the ambulacral grooves which contain the tube-feet, and then spread the spines over them protectively.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Sea Star Wasting Syndrome

Pisaster ochraceus is the first sea star species observed with “starfish wasting syndrome,” a plague of significant concern to scientists, which causes sea stars along the North American Pacific coast to soften, lose their arms, and eventually disintegrate, sometimes just days after first symptoms appear.  The outbreak is similar die-offs in 1970 and in 1990, however far more geographically expansive and affecting far more individuals.  Scientists first sighted symptoms of the syndrome in September 2013 on sea stars on the Olympic Penninsula in Washington state; since then, massive population declines of many sea star species have been documented along much of the North American west coast, and continue to erupt in previously unaffected areas. 

Known as a “keystone species” in the marine intertidal and subtidal ecosystems, the sharp population decline of P. ochraceus is expected to trigger wide-ranging changes in the relative compositions of other species, and cause a fundamental disruption at ecosystem level.  Scientists still do not know the underlying cause for the wasting syndrome, and are examining potential infectious agents and environmental changes that might be implicated.

(Raimondi 2014; SeaStarWasting.org 2014 and references therein)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Dana Campbell

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

The neurosensory cells scattered over the asteroid body respond to mechanical, chemical, and optical stimuli. Sensory organs are developed only at the base of each terminal tentacle. At this location a great number of light-sensitive cells form an optic cushion which contains several ocelli.

Communication Channels: chemical

Perception Channels: visual ; tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Pisaster ochraceous develops through several larval stages, one including the brachiolaria larva. Using ciliated arms to sweep food into its mouth, it glides through the water column. The cilia drive locomotion of the larva is supplemented by these same arms. The larva attaches itself to the substratum as it settles because each arm has a glandular tip. The five-armed adult is formed because it undergoes metamorphosis. Adults continue growing and the rate of growth is dependent on its food supply.

Development - Life Cycle: metamorphosis

  • Ricketts, E., J. Calvin, J. Hedgpeth. 1985. Between Pacific Tides. Stanford, California: Stanford University Press.
  • Nicol, J. 1960. The Biology of Marine Animals. New York: Interscience Publishers, INC.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

From studies in oceans and aquariums, it seems that many asteroids achieve a minimal life span of four to six years, and Pisaster ochraceous could reach an age of twenty years.

Typical lifespan

Status: wild:
20 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Pisaster ochraceous is mainly dioecious. The male gametes develop, but later only females ones are produced. During a transitional period, both eggs and sperm are produced. A pair of gonads branches into each arm off a circular genital strand located along the oral inner surface of the disc. Each gonad looks like a feathery cluster of tubules. During maturation of the gametes, the gonads greatly increase in size, pushing into the perivisceral cavity of the arms, often right up to the ends of the arms. The gonopores of the individual gonads open at the bases of the arms.

Breeding season: Spring

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); broadcast (group) spawning

There is no parental investment beyond spawning.

Parental Investment: pre-fertilization (Provisioning)

  • Grzimeck, B. 1972. Grzimeck's Animal Life Encyclopedia Volume 3 Mollusks and Echnoderms. New York, Cincinnati, Chicago: Van Nostrand Reinhold Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Body buffers thermal variations: sea star
 

The body of sea stars helps buffer thermal variations experienced in low tide by taking up and storing cold sea water during high tide.

     
  "The body temperature of ectotherms is influenced by the interaction of abiotic conditions, morphology, and behavior. Although organisms living in different thermal habitats may exhibit morphological plasticity or move from unfavorable locations, there are few examples of animals adjusting their thermal properties in response to short-term changes in local conditions. Here, we show that the intertidal sea star Pisaster ochraceus modulates its thermal inertia in response to prior thermal exposure. After exposure to high body temperature at low tide, sea stars increase the amount of colder-than-air fluid in their coelomic cavity when submerged during high tide, resulting in a lower body temperature during the subsequent low tide. Moreover, this buffering capacity is more effective when seawater is cold during the previous high tide. This ability to modify the volume of coelomic fluid provides sea stars with a novel thermoregulatory 'backup' when faced with prolonged exposure to elevated aerial temperatures." (Pincebourde et al. 2009:890)
  Learn more about this functional adaptation.
  • Pincebourde S; Sanford E; Helmuth B. 2009. An intertidal sea star adjusts thermal inertia to avoid extreme body temperatures. American Naturalist. 174(6): 890-7.
  • Bourton J. 2009. Starfish 'pump up' to cool down. BBC Earth News [Internet],
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pisaster ochraceus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 398 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGCAACTAAGACGCTGACTATTTTCTACTAAACACAAGGATATTGGTACTCTTTATTTAATATTTGGAGCATGAGCTGGCATGATAGGCACCGCTATGAGTGTTATAATTCGCACTGAACTTGCTCAACCCGGATCTCTACTACAAGACGACCAAATTTACAAAGTTATAGTTACTGCTCACGCTCTCGTAATGATATTTTTTATGGTTATGCCTATAATGATTGGGGGATTTGGTAAATGATTAATCCCTCTAATGATTGGCGCACCAGATATGGCCTTTCCCCGGATGAAAAAAATGAGATTTTGACTAATACCCCCTTCTTTTCTTTTACTTCTAGCTTCTGCCGGAGTTGAAAGTGGAACTGGTACTGGATGAACTATCTATCCTCCACTGTCCAGGGGTTTAGCTCATGCTGGAGGGTCAGTTGATCTCGCCATATTTTCTCTCCACCTAGCCGGAGCCTCCTCTATACTTGCCTCCATTAACTTTATTACTACTATTATAAAAATGCGAACACCCGGCATGTCCTTTGACCGACTTCCTTTATTTGTATGATCCGTTTTCGTTACCGCTTTTCTTTTACTTCTTTCTCTTCCTGTATTAGCCGGAGCAATTACAATGCTATTAACCGACCGAAAAATTAATACTACTTTTTTTGACCCTGCTGGAGGAGGTGATCCGATACTCTTTCAACACTTATTCTGATTTTTTGGCCATCCAGAAGTATATATTCTTATTCTCCCCGGATTTGGCATGATTTCTCACGTGATAGCTCACTATGCTGGAAAGAAAGAACCTTTTGGATACCTAGGCATGGTGTACGCAATTATATCTATAGGAATACTGGGATTTCTCGTATGAGCTCACCATATGTTCACCGTTGGAATGGATGTAGATACACGAGCCTACTTCACTGCTGCCACAATGATTATTGCTGTGCCCACAGGAATTAAGGTCTTTAGATGAATGGCCACTTTGCAAGGAAGAAAACTACGATGGGACACACCTCTTCTCTGAGCACTAGGCTTTGTATTTTTATTCACAATAGGAGGACTAACTGGAGTAGTACTAGCAAACTCTTCTATAGATATAATCTTACATGATACACATTACGTAGTTGCCCACTTTCACTACGTATTATCCATGGGAGCTGTATTCGCAATATTCGCAGGATTTACCCACTGATTTCCTTTATTCTCAGGAGTTAGACTACATCCTTTATGAAGAAAGGTTCACTTCGCAGTAATGTTTATAGGAGTTAAACTAACCTTCTTCCCCCAACACTTCTTAGGTCTGGCCGGTATGCCTCGCCGCTACTCAGACTACCCAGACGCCTACACCCTATGAAACACCGTATCTTCTATAGGATCTACTATATCCCTAATACGTACGCTAATTTTTCTGTTCCTAATTTGAGAAGCTTTCTCTACCAAGCGAACCCCTATCCACCCTGAATTCTCCTCTTCCTCCCTAGAATGACAGTACCCCTCATTTCCTCCCTCTCATCATACTTTTGACGAAACTCCTTCTGCTGTCTATCTAATTAAGTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pisaster ochraceus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 392
Specimens with Barcodes: 392
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 7 specimens with morphological vouchers housed at Queensland Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

The only positive benefit for humans is that they are admired by tourists as they are clinging to the rocks on a bay area.

Positive Impacts: research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pisaster ochraceus

Pisaster ochraceus, generally known as the purple sea star, ochre sea star or ochre starfish, is a common starfish found among the waters of the Pacific Ocean. Identified as a keystone species, Pisaster is considered an important indicator for the health of the intertidal zone.[2]

Description[edit]

This sea star has five stout rays that range in length from 10 to 25 centimeters (4 to 10 in). The rays are arranged around an ill-defined central disk. While most individuals are purple, they can be orange, orange-ochre, yellow, reddish, or brown. The aboral surface contains many small spines (ossicles) that are arranged in a netlike or pentagonal pattern on the central disk. The ossicles are no higher than 2 mm.[3][4] In Pisaster the tube feet have suckers on their distal ends which allow them to attach to the rocky substrate and live in heavily wave-swept areas.[5]

Two species that can be mistaken for Pisaster ochraceus are Pisaster giganteus, which has blue rings around white or purple spines, and Pisaster brevispinus, which is pink with small white spines. These two species have different aboral spines and coloration which allows one to distinguish between the species. Evasterias troscheli may be confused with Pisaster ochraceus at times as well. It can be distinguished by its smaller disk size and longer, tapering rays which are often thickest a short distance out from their base rather than at the base as in Pisaster ochraceus.[4]

Reproduction and life history[edit]

Reproduction[edit]

Pisaster are dioecious but there is no sexual dimorphism and sexes can only be separated by the presence of eggs or sperm in the gonads. They reproduce by broadcast spawning, which occurs in the Puget Sound around May to July.[4] There is no parental investment beyond spawning.[6] Fertilization occurs in the water column and Pisaster ochraceous develops through several larval stages.[7]

The reproductive system consists of a pair of gonads branching into each ray off a circular genital strand which is along the oral inner surface of the central disc.[6] The gonads looks like a feathery collection of tubules. In females there are orange gonads and in males they are whitish.[5] During maturation of the gametes, the gonads increase in size and can account for up to 40 percent of the sea star's weight.[4] The gonopores are too small to be seen, and can only be found when the sea stars are spawning.[4][7]

Lifespan[edit]

Many sea stars live to a minimal age of four years. The Pisaster ochraceus could live as long as twenty years.[6]

This species of seastar is often considered a keystone species in many intertidal regions. Pisaster ochraceus is a predator of the California mussel, Mytilus californianus and reduces its abundance. This allows for other macroinvertebrates to persist. In an experimental removal of Pisaster ochraceus, it was shown that Mytilus californianus becomes almost completely dominant of the intertidal community. When Pisaster ochraceus is present there is a diverse intertidal community.[8]

Feeding[edit]

At the larval stage, Pisaster ochraceus are filter feeders and their diet consists of plankton. As an adult, Pisaster ochraceus feeds on mussels such as Mytilus californianus and Mytilus trossulus. They also feed on chitons, limpets, snails, barnacles, echinoids, and even decapod crustacea.[4][9][10]

Pisaster ochraceus uses its tube feet to handle its prey. If the prey is too large to be swallowed whole, then it can use its tube feet to open shells. It can evert its stomach through its mouth and engulf its prey, liquify it with digestive enzymes and ingest the processed food. Mussels hold their valves together very securely but Pisaster ochraceus can insert part of its everted stomach, or some digestive juices, through the narrow gap that exists where the byssal threads emerge from the shell. The mussel needs to open its valves periodically to feed and breathe and the sea star can exert a powerful traction with its tube feet, pulling the two valves further open. Once the stomach is inside the mussel, digestion takes place. It is thought one sea star can consume eighty Californian mussels in a year.[11]

Ecology and distribution[edit]

Conservation[edit]

Pisaster ochraceus has been described as a keystone species. Experiments by zoologist Robert T. Paine in the 1960s demonstrated that a loss of only a few individual Pisaster seastars had a profound impact on mussel bed population, thereby reducing the health of the intertidal environment.[2] With only few natural predators (sea otters and seagulls) it is suggested that the principal enemies of Pisaster are human collectors and casual tidepool visitors.[12] Pisaster ochraceus has not been evaluated by the International Union for Conservation of Nature (IUCN).[6]

Geographic range[edit]

Pisaster ochraceus can be found from Prince William Sound in Alaska to Point Sal in Santa Barbara Co., California. Pisaster found within the warmer waters from Santa Barbara County to Baja, California is Pisaster ochraceus segnis, a subspecies of Pisaster ochraceus.[13]

Habitat[edit]

This sea star can be found in great numbers on mussel beds and on wave-washed rocky shores. The juveniles are often found in crevices and under rocks.[7] Its depth range is from above the low-tide zone to 90 m in depth. Pisaster ochraceous is very durable and can tolerate a loss of thirty-percent of its body weight in body fluids.[6]

Effects from ocean acidification[edit]

A study found that Pisaster ochraceus will not be affected by ocean acidification in the same way as most calcareous marine animals. This normally causes decreased growth due to the increased acidity dissolving calcium carbonate. Researchers found that when Pisaster ochraceus was exposed to 21 °C (70 °F) and 770 ppm CO
2
(beyond rises expected in the next century) that they survived. It is thought that this is because the animals' calcium is nodular and so it is able to compensate for the lack of carbonate by growing more fleshy tissue instead.[14][15]

References[edit]

  1. ^ Christopher Mah (2010). "Pisaster ochraceus (Brandt, 1835)". In C. L. Mah. World Asteroidea database. World Register of Marine Species. Retrieved February 1, 2012. 
  2. ^ a b Power, Mary E., et al. "Challenges in the quest for keystones." BioScience 46.8 (1996): 609-620.
  3. ^ Kozloff, E. N. (1996). Marine Invertebrates of the Pacific Northwest. Seattle: University of Washington Press.
  4. ^ a b c d e f McFadden, M. (2002). Pisaster ochraceus. Retrieved May 10, 2010, from http://www.wallawalla.edu/academics/departments/biology/rosario/inverts/Echinodermata/Class%20Asteroidea/Pisaster_ochraceus.html
  5. ^ a b Nybakken, J. (1996). Diversity of the invertebrates. Hayward: California State University
  6. ^ a b c d e "Pisaster ochraceus (Brandt, 1835)". Encyclopedia of Life. Retrieved May 10, 2010, from "http://www.eol.org/pages/598469".
  7. ^ a b c Ramirez,Y. (2002). Pisaster ochraceus, Animal Diversity Web. Retrieved May 10, 2010, from http://animaldiversity.ummz.umich.edu/site/accounts/information/Pisaster_ochraceus.html.
  8. ^ Holsinger, K. (2005). Keystone species. Retrieved May 10, 2010, from http://darwin.eeb.uconn.edu/eeb310/lecture-notes/interactions/node2.html
  9. ^ C. D. G. Harley, M. S. Pankey, J. P. Wares, R. K. Grosberg, M. J. Wonham (2006). "Color Polymorphism and Genetic Structure in the Sea Star Pisaster ochraceus". The Biological Bulletin 211 (3): 248–262. doi:10.2307/4134547. JSTOR 4134547. PMID 17179384. 
  10. ^ Holmes, Jan (2002). "Seashore Players Most Successful When They're in Their Zone". WSU BEACH WATCHERS. Education. Research. Stewardship. Retrieved 6 March 2010. [dead link]
  11. ^ Langstroth, Lovell; Libby Langstroth, Todd Newberry (2001). A living bay: the underwater world of Monterey Bay. Google Books. p. 29. 
  12. ^ Ricketts, Edward K.; Calvin, Jack; Hedgepeth, Joel (1985). Between Pacific Tides (5th ed.). Stanford University Press. p. 217. ISBN 9780804720687. 
  13. ^ Humphreys, V. (2003). The Biogeography of the Purple Ochre Sea Star (Pisaster ochraceus). Retrieved May 10, 2010, from http://bss.sfsu.edu/holzman/courses/Fall%2003%20project/oseastar.htm
  14. ^ "Starfish defy climate change gloom". New Scientist. 30 May 2009. Retrieved June 9, 2009. 
  15. ^ Gooding, Rebecca; Christopher Harley and Emily Tang (June 9, 2009). "Elevated water temperature and carbon dioxide concentration increase the growth of a keystone echinoderm". Proceedings of the National Academy of Sciences 106 (23): 9316–9321. doi:10.1073/pnas.0811143106. PMC 2695056. PMID 19470464. Retrieved 10 June 2009. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!