Ecology

Habitat

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 105 specimens in 2 taxa.
Water temperature and chemistry ranges based on 69 samples.

Environmental ranges
  Depth range (m): 0 - 1032
  Temperature range (°C): 2.232 - 11.024
  Nitrate (umol/L): 5.774 - 41.511
  Salinity (PPS): 31.692 - 34.216
  Oxygen (ml/l): 0.545 - 6.616
  Phosphate (umol/l): 0.883 - 3.312
  Silicate (umol/l): 12.975 - 109.054

Graphical representation

Depth range (m): 0 - 1032

Temperature range (°C): 2.232 - 11.024

Nitrate (umol/L): 5.774 - 41.511

Salinity (PPS): 31.692 - 34.216

Oxygen (ml/l): 0.545 - 6.616

Phosphate (umol/l): 0.883 - 3.312

Silicate (umol/l): 12.975 - 109.054
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Orthasterias koehleri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AGACGATGACTATTTTCTACTAAACACAAGGATATTGGTACTCTATATCTAATCTTCGGAGCCTGAGCTGGCATGATAGGAACCGCTATGAGTGTTATAATACGCACTGAACTTGCCCAACCAGGGTCTTTACTACAGGAC---GACCAGATATATAAAGTTATAGTTACTGCTCACGCCCTGGTTATGATATTTTTTATGGTAATGCCAATAATGATTGGTGGATTTGGTAAATGACTTATACCGCTAATGATTGGAGCACCAGACATGGCATTCCCTCGCATGAAAAACATGAGCTTTTGACTGATTCCTCCCTCTTTTCTACTTCTTCTAGCTTCCGCGGGAGTTGAAAGAGGAGCCGGTACCGGCTGAACCATTTATCCCCCCCTATCCAGGGGCCTCGCCCATGCTGGGGGATCAGTTGACCTCGCCATATTCTCTCTTCACTTGGCTGGTGCTTCTTCCATCTTAGCCTCTATTAAATTTATTACTACAATAATAAAAATGCGAACACCTGGCATGTCCTTCGATCGCCTTCCTTTATTTGTATGGTCCGTTTTCGTCACCGCATTTCTACTTNTACTTTCCCTTCCTGTCCTAGCCGGAGCAATAACAATGCTGCTAACAGACCGGAAAATCAAAACAACTTTTTTTGACCCCGCCGGTGGGGGAGACCCCATTCTATTTCAACATCTCTTCTGATTTTTTGGTCACCCTGAAGTTTATATACTTATTTTGCCAGGGTTTGGAATGATATCACACGTAATAGCCCATTACGCCGGTAAGAACGAACCTTTTGGGTACTTAGGCATGGTCTACGCCATTATATCCATCGGTATATTAGGATTTCTTGTATGAGCCCACCACATGTTTACCGTAGGAATGGACGTTGACACGCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Orthasterias koehleri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Orthasterias

Orthasterias is a genus of sea stars in the family Asteriidae. Orthasterias koehleri, the rainbow star or red-banded sea star, is the only species in the genus. It is found in the North Pacific Ocean.

Description[edit]

The rainbow star is a large starfish, growing to a diameter of about 50 centimetres (20 in) with an arm length of 21 centimetres (8.3 in). It usually has five slender tapering arms and the aboral (upper) surface is pink or red with irregular patches or bands of darker red, orange or grey. The surface is covered with sharp white or mauve spines, each surrounded by a ring of pedicellariae, tiny pincer-like organs.[3][4]

Distribution and habitat[edit]

The rainbow star is found in northern parts of the Pacific Ocean with its range extending from California to Alaska at depths down to about 250 metres (820 ft).[3] It also occurs in mid-ocean on knolls and seamounts.[2] It is an uncommon species and is usually found on soft bottoms of mud or sand, or on kelp or rock surfaces.[3]

Biology[edit]

The rainbow star is a predator and feeds on a range of invertebrates including gastropod molluscs, limpets, bivalves, brachiopods, chitons, barnacles and tunicates.[4] In Alaska, it especially favours the ribbed clam Humilaria kennerleyi.[5] It can dig up clams buried in the substrate and force the valves apart with the suction provided by its tube feet. It then everts part of its stomach, thrusting a fold inside the bivalve and excreting digestive enzymes onto the tissues. When these have liquefied sufficiently, the stomach engulfs them and is returned to its normal position inside the starfish.[3][6]

The rainbow star is sometimes attacked by a voracious predator, the morning sun star (Solaster dawsoni). It attempts to defend itself by winding its arms round the attacker and nipping it with its thousands of pedicellariae.[7]

References[edit]

  1. ^ Mah, C.; Hansson, H. (2012). "Orthasterias Verrill, 1914". In C. L. Mah. World Asteroidea database. World Register of Marine Species. Retrieved 2012-09-22. 
  2. ^ a b c Mah, C. (2012). "Orthasterias koehleri (deLoriol, 1897)". In C. L. Mah. World Asteroidea database. World Register of Marine Species. Retrieved 2012-09-22. 
  3. ^ a b c d "Orthasterias koehleri". Race Rocks Taxonomy. 2002. Retrieved 2012-09-22. 
  4. ^ a b McDonald Gary (2010). "Orthasterias koehleri (de Loriol, 1897)". Intertidal Invertebrates of the Monterey Bay Area, California. Retrieved 2012-09-23. 
  5. ^ "Redbanded Sea Star, Orthasterias koehleri and the Blood Star, Henricia leviuscula". Alaska Fisheries Science Center. Retrieved 2012-09-23. 
  6. ^ Dorit, R. L.; Walker, W. F.; Barnes, R. D. (1991). Zoology. Saunders College Publishing. p. 782. ISBN 0-03-030504-7. 
  7. ^ "Morning sun star: Solaster dawsoni". Sea stars of the Pacific Northwest. 2011. Retrieved 2012-09-24. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!