Overview

Comprehensive Description

Biology/Natural History: This species is a voracious subtidal predator, feeding on bivalves, snails, chitons, urchins, other asteroids, sea cucumbers, sand dollars, and crabs (in other words, just about anything it wants!). It will also scavenge dead animals. It may be the largest and fastest seastar in the world. It can move up to 3 meters per minute, and has been known to travel at least 3 km. It has over 15,000 tube feet. Tiny, newly metamorphosed juveniles of this species have only 5 rays but rays are added as the individual grows. Has very prominent spines and (crossed) pedicellariae, plus purple papulae. Loss of rays upon handling seems to be due to autotomy. In Puget Sound this species excavates butter clams (Saxidomus gigantea) by picking up sediment particles over the clam, passing them out to the ends of the rays, and dropping them. Often eat urchins such as Strongylocentrotus purpuratus, whose spines may pierce through from the stomach to the aboral surface. Can evert its stomach but more often swallows its prey whole. Predators include Alaska King crab and some large Cancer crabs. Individuals are agressive toward one another (and to almost any other seastar). Spawns March to July (some also in winter); has fertilizable eggs at least from December to June. May stand on the tips of their rays while spawning. Pelagic larvae metamorphose to benthic, 5-rayed juveniles at 9-10 weeks.

This species has a large, fleshy body with an only loosely articulated skeleton, and relies on fluid pressure to maintain its body form. It appears to rely more heavily on fluid uptake through the surface than on uptake through the madreporite. Its perivisceral fluid is more hyperosmotic than that of several other local species. This may aid in fluid uptake (Ferguson, 1994) and maintaining body form.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

This is the largest seastar in the Rosario area, with a diameter of up to 90 cm. It has 20 or more rays (but occasionally may be as few as 15), abundant pedecellariae, and many spines projecting from its limp, flaccid tissue (picture). A row of spines along the margins of the rays is longer than the other spines. Nearly always orange or pinkish; sometimes purplish (photo), yellowish, or brown; with white spines.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Pycnopodia helianthoides is commonly found in marine environments ranging from the shallow waters of the Aleutian Islands, Alaska, to San Diego, California.

Biogeographic Regions: nearctic ; pacific ocean

  • Lambert, P. 2000. Sea Stars of British Columbia, Southeast Alaska and Puget Sound. Vancouver: UBC Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

California, Oregon
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographical Range: Unalaska Island, Alaska to Baja California; uncommon south of Monterey Bay

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Pycnopodia helianthoides, the largest of the sea stars, is radially symmetrical. The sunflower star has more arms than any other species, numbering between 15 and 24 (most sea stars have between 5 and 14), and is the heaviest known sea star, weighing about 5 kg. Their arms are up to 40 cm long and they are usually around 80 cm in diameter. The colors vary. Some are reddish-orange to yellow, violet brown, purplish or slatey purple. The stomach is found on the underside of the center body, or the oral surface. This area is usually a lighter color with yellow or orange tube feet. Pycnopodia helianthoides has over 15,000 tube feet which have suction cups that allow the stars to cling to rocks. The suctions cups are so strong that if you try to pull a sea star of a rock, the suctions cups may break lose from the sea star and continue to stick on the rock.

Other Physical Features: ectothermic ; heterothermic ; radial symmetry

Sexual Dimorphism: sexes alike

  • Ahearn, G., R. Benhnke. 1991. Diet, Feeding-Behaviour, and Surface-Morphology of the Multiarmed Antartic Sea Star Labidiaster-Annulatus. Marine Ecology- Progress Series, 77/1: 65-84.
  • Esquivel, C. 2003. "Critter Care Club-species list: Invertebrates" (On-line). Accessed December 08, 2004 at http://www.cabrilloaq.org/critter1.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

How to Distinguish from Similar Species: This seastar is larger and has more rays than any other seastar in our area. Small individuals could be confused with Solaster dawsoni or Crossaster papposus, but both of those species have 16 or less rays, have no pedicellariae, and are not as markedly limp as Pycnopodia is.. S. dawsoni also does not have the prominent projecting spines, and C. papposus' spines are not extra prominent along the margins of the rays as they are in this species.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Sunflower stars are commonly found on various substrates like mud, sand, gravel, boulders and rock. They are found from the intertidal zone to 435 m, however, most are found no more than 120 m.

Range depth: 435 (high) m.

Habitat Regions: temperate ; saltwater or marine

Aquatic Biomes: benthic

Other Habitat Features: intertidal or littoral

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 314 specimens in 1 taxon.
Water temperature and chemistry ranges based on 159 samples.

Environmental ranges
  Depth range (m): -2 - 203.5
  Temperature range (°C): 6.431 - 10.345
  Nitrate (umol/L): 5.634 - 32.233
  Salinity (PPS): 31.235 - 33.811
  Oxygen (ml/l): 2.565 - 6.794
  Phosphate (umol/l): 0.883 - 2.545
  Silicate (umol/l): 12.975 - 51.234

Graphical representation

Depth range (m): -2 - 203.5

Temperature range (°C): 6.431 - 10.345

Nitrate (umol/L): 5.634 - 32.233

Salinity (PPS): 31.235 - 33.811

Oxygen (ml/l): 2.565 - 6.794

Phosphate (umol/l): 0.883 - 2.545

Silicate (umol/l): 12.975 - 51.234
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth Range: Low intertidal to 435 m. Nearly always subtidal.

Habitat: Mostly subtidal, rocky, gravelly, or sandy bottoms.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Pycnopodia helianthoides is primarily carnivorous, feeding on mussels, sea urchins, fish, crustaceans (crabs and barnacles), sea cucumbers, clams, gastropods, sand dollars, and occasionally algae and sponges. However, the diet varies with geographic location and the availability of prey. For example, on the west coast, studies show that sea urchins are its main prey. For most sunflower stars, sea urchins make up 21-98% of their diet. Sunflower stars use their strong sense of smell and very sensitive indicators of light and dark to find their prey, and can move at a quick rate of 10 cm per second or 18 feet per minute. While moving, it puts its leading 8 arms in front and when it contacts the prey, it throws the leading arms down on top of the prey. Pycnopodia helianthoides then protrudes its stomach, envelops the entire prey, and digests it. The arms and greatly expandable tube feet are the basic tools of prey capture. Many species have developed escape responses to sunflower stars. For example, the abalone Haliotis accelerates and at the same time whips it shell back and forth to break the grasp of the tube feet of the sea star.

Animal Foods: mollusks; aquatic crustaceans; echinoderms; other marine invertebrates

Plant Foods: algae

Primary Diet: carnivore (Eats non-insect arthropods, Molluscivore , Eats other marine invertebrates); herbivore (Algivore); omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Pycnopodia helianthoides regulates the structure of the benthic community. Between Oregon and the northern Gulf of Alaska, this abudant sea star is the only species considered to be an important sea urchin predator. Pycnopodia helianthoides coexists with its prey while otters decimate urchin populations; therefore, they have a more subtle effect. Pycnopodia helianthoides creates small-scale, prey-free patches by consuming few prey individuals, while the remaining prey exhibit a strong escape response. Since the urchins are herbivorous, the short-term existence of prey-free patches can influence plant diversity and community primary productivity.

  • Duggins, D. 1983. Starfish Predation and the Creation of Mosaic Patterns in a Kelp-Dominated Community. Ecology, 64/6: 1610-1619.
  • Dayton, P. 1975. Experimental Evaluation of Ecological Dominance in a Rocky Intertidal Algal Community. Ecological Monographs, 45/2: 137-159.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Sea stars have very few predators, especially P. helianthoides. Sometimes Alaska king crab and sea otters may attack sea stars. Birds such as gulls have been known to prey upon sunflower stars. The magnitude of loss of intertidal P. helianthoides is enough to explain the near absence of these soft-bodied sea stars in the intertidal zone of Tatoosh. Pycnopodia helianthoides can have large subtidal populations that do not experience bird predation resulting in a little effect on their total population sizes. Predators mainly eat the sea stars during their larval and juvenile stages. The availability of food, rather than predation, limits the number of adult sunflower stars.

Known Predators:

  • Wootton, J. T. 1997. Estimates and Tests of Per Capita Interaction Strength: Diet, Abundance, and Impact of Intertidially Foraging Birds. Ecological Monographs, 67/1: 45-64.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

If a predator attacks, P. helianthoides can let its arm drop off and send a chemical that causes an alarm response to other sunflower stars in the area. If its arm is irritated or disturbed by a predator, it will drop it off or autotomize its arm. The autotomy is triggered by a chemical that is released by injured tissues. This allows sunflower stars to escape from the predator holding onto its arm.

Communication Channels: chemical

Other Communication Modes: pheromones

Perception Channels: visual ; tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

The eggs develop into swimming, bilateral larvae that usually remain in the plankton for no more than 10 weeks. The larval form feeds on single-celled plants. When the larva settles on the bottom it metamorphoses into a young sea star with five arms. The young P. helianthoides initially feeds on the thin layer skin-celled plants that coat the bottom of their marine habitat. The juvenille soon adds an arm clockwise from the bivium. Additional arms are added bilaterally in pairs to either side of the sixth ray. Each new pair is inserted between the last pair formed and the adjacent original arms.

Development - Life Cycle: metamorphosis

  • Alender, C., J. Anderson, J. Binyon, R. Boolootian, D. Davenport. 1966. Physiology of Echinodermata. New York: Interscience.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Sea stars have a life span usually between 3 and 5 years.

Typical lifespan

Status: wild:
3 to 5 years.

Average lifespan

Status: wild:
3-5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

There is no sexual dimorphism within these species. Fertilization is external.

Mating System: polygynandrous (promiscuous)

Pycnopodia helianthoides breeds by broadcast fertilization between March and July. However, the main peak is May and June. Each separate sex sheds its eggs or sperm into the water where the fertilization takes place by chance.

Breeding interval: Between March and July

Key Reproductive Features: seasonal breeding ; sexual ; fertilization (External ); oviparous

There is no parental care within this species.

Parental Investment: pre-fertilization (Provisioning)

  • Lawrence, J. 1987. A Functional Biology of Echinoderms. Baltimore: The John Hopkins University Press.
  • Lambert, P. 2000. Sea Stars of British Columbia, Southeast Alaska and Puget Sound. Vancouver: UBC Press.
  • Alender, C., J. Anderson, J. Binyon, R. Boolootian, D. Davenport. 1966. Physiology of Echinodermata. New York: Interscience.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pycnopodia helianthoides

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AGACGCTGACTATTTTCTACTAAACACAAGGATATTGGMACTCTATATCTTATATTTGGAGCTTGGGCCGGGATGATAGGCACTGCTATAAGAGTAATAATACGTACCGAACTTGCCCAACCTGGATCTTTACTACAAGAC---GATCAAATATACAAAGTTGTAGTGACTGCTCACGCCCTGGTGATGATATTTTTTATGGTAATGCCTATAATGATAGGTGGATTTGGTAACTGACTTATTCCTCTTATGATTGGAGCACCAGATATGGCTTTCCCTCAAATGAAAAACATGATATTTTGACTAATTCCCCCCTCTTTCTTACTTCTTCTGGCTTCTGCCGGCGTTGAAAGAGGAGCTGGAACTGGTTGGACTATTTACCCCCCTCTATCAAGAGGATTAGCCCACGCAGGAGGATCAGTCGACCTTGCCATATTCTCTCTACATTTGGCAGGAGCTTCTTCTATACTAGCCTCAATTAAATTTATTACCACAATTATAAACATGCGAACTCCCGGTATGTCTTTTGACCGCCTACCCCTGTTTGTATGATCCGTTTTCGTTACTGCTTTCTTGCTCCTTCTTTCACTACCTGTACTAGCGGGAGCAATTACTATGTTATTAACAGATCGAAAAATAAACACCACTTTCTTTGACCCTGCTGGAGGAGGTGACCCTATTCTGTTTCAACATCTTTTCTGATTCTTTGGTCACCCCGAGGTGTACATTTTGATACTCCCCGGGTTTGGAATGATTTCTCACGTAATAGCACACTACGCCGGCAAGAACGAACCCTTTGGGTATCTCGGAATGGTATACGCAATTATATCTATTGGAATACTTGGCTTCCTAGTTTGGGCCCACCATATGTTTACCGTTGGGATGGACGTTGATACGCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pycnopodia helianthoides

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Queensland Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

This species is viewed by many commercial fishers as a pest. The results of the sunflower star's predacious behavior fouls long-line gear and crab pots.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

There was no information regarding the economic importance of P. helianthoides to humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Sunflower seastar

Pycnopodia helianthoides, commonly known as the sunflower seastar, is a large sea star found in the northeast Pacific. It is the largest sea star in the world, with a maximum armspan of 1 m (3.3 ft). Sunflower seastars usually have 16 to 24 limbs; their color can vary widely. They are predatory, feeding mostly on sea urchins, clams, snails, and other small invertebrates.

Contents

Description

Sunflower seastars can grow to have an arm span of 1 m (3.3 ft) in diameter.[2] Their color ranges from bright orange, yellow and red to brown and sometimes to purple, with soft, velvet-textured bodies and 16 to 24 arms with powerful suckers.[2][3] Most sea star species have a mesh-like skeleton to protect their internal organs.[4]

Distribution and habitat

Sunflower seastars are common in the northeast Pacific from Alaska to Southern California,[2] and are largest in Puget Sound, British Columbia and Alaska.[4] They generally inhabit low subtidal and intertidal areas rich in seaweed[5] or kelp.[6] They do not venture into high- and mid-tide areas because their body structure is fleshy and requires water to support it.[7]

Ecology

Sunflower seastars are quick, efficient hunters, moving at a speed of 1 m/min (3.3 ft/min) using 15,000 tube feet which lie on the undersides of their bodies.[2][3] They are commonly found around urchin barrens, as the sea urchin is a favorite food. They also eat clams, snails, abalone, sea cucumbers and other sea stars.[2] In Monterey Bay, California, they will feed on dead or dying squid.[8] Although the sunflower seastar can greatly extend its mouth, for larger prey, the stomach can extend outside the mouth to digest prey, such as gastropods like abalone.[9]

Easily stressed by predators such as large fish and other sea stars, they can shed arms to escape, which will grow back within a few weeks. They are preyed upon by the king crab.[4]

Underside of a sunflower seastar

Reproduction

Sunflower seastars can reproduce either asexually through fissiparity or sexually through broadcast spawning.[10] They also have separate sexes.[9] Sunflower seastars breed from May through June. In preparing to spawn, they arch up using a dozen or so arms to hoist their fleshy central mass free of the seafloor and release gametes into the water for external fertilization.[9] The microscopic sea star larvae float and feed near the surface for two to 10 weeks. After the planktonic larval period, the larvae settle to the bottom and transform into juveniles.[4] Juvenile sunflower seastars begin life with five arms, and grow the rest as they mature.[8] The lifespans of most seastars is three to five years.

In popular culture

Their feeding behavior was filmed for the BBC in the 2006 nature documentary Planet Earth and again in 2009 for Life.

References

  1. ^ "Pycnopodia helianthoides". Integrated Taxonomic Information System. Retrieved 9 April 2007. 
  2. ^ a b c d e Sunflower seastar - NOAA
  3. ^ a b Telnack, Jennifer. Intertidal Marine Invertebrates of the South Puget Sound, NW Marine Life.
  4. ^ a b c d Sunflowerstar. Scott Boyd's Emerald Sea Photography.
  5. ^ North Coast Intertidal Guide: Seastars & Urchins, Humboldt State University. Arcata, CA.
  6. ^ Sunflower Star. Channel Islands National Park. National Park Service.
  7. ^ Sunflower Star. North Island Explorer.
  8. ^ a b Monterey Bay Aquarium: Online Field Guide - Sunflower star. Monterey Bay Aquarium.
  9. ^ a b c Sea stars and relatives, Edmonds Discovery Programs, City of Edmonds, Washington.
  10. ^ Aaron Shepard. "Pycnopodia helianthoides, The Sunflower Star". Evergreen State College. Retrieved 28 February 2012. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!