Articles on this page are available in 1 other language: Arabic (11) (learn more)

Overview

Distribution

Arctic Ocean, Canadian Exclusive Economic Zone [Atlantic part], Canadian part of the Arctic Ocean, Cobscook Bay, Denmark, Dutch Exclusive Economic Zone, England, European waters (ERMS scope), German Bight, Grand Banks, Gulf of Mexico, Gulf of St. Lawrence, Manicouagan, North Pacific, North Sea, North West Atlantic, Northern North Pacific, Norway, Saguenay Fjord, Saint Lawrence River, Shetlands, St. Lawrence Estuary, Swedish Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Occaasional, in 100 to 200 m depth around Shetland and in the northern North Sea
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

"Disc: Up to 40 mm in diameter with rounded sides. The radial shields are roughly triangular, about twice as long as their width. The arm combs are composed of conical or triangular papillae separated at their tips.

Arms: The dorsal arm plates are short and wide; the ventral plates are triangular and usually separated by the bases of the lateral arm plates. Each arm has three spines: the upper two are 1.5 to 2 times as long as a joint; at the arm tip, the middle spine is longest. The tentacle scales are broad and flat, four or five to each podial pore, but as few as one distally.

Mouth: Four to six pointed oral papillae on each side. Narrow adoral shields partially wrap around the oral shield, which is as broad as it is long.

Colour: The disc is usually brown or grey, but may be mottled. The arms are grey or lighter than the disc. Both the disc and arms are white ventrally." (Lambert, Austin 2007)

Public Domain

Browne, Joy

Source: EOL Interns LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

"Easily confused with Ophiura luetkenii, which co-occurs with O. sarsii." (Lambert, Austin 2007)

Public Domain

Browne, Joy

Source: EOL Interns LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 2550 specimens in 2 taxa.
Water temperature and chemistry ranges based on 1461 samples.

Environmental ranges
  Depth range (m): 0 - 45627
  Temperature range (°C): -1.617 - 20.470
  Nitrate (umol/L): 0.877 - 44.345
  Salinity (PPS): 23.803 - 36.380
  Oxygen (ml/l): 0.853 - 8.398
  Phosphate (umol/l): 0.203 - 3.128
  Silicate (umol/l): 1.228 - 115.593

Graphical representation

Depth range (m): 0 - 45627

Temperature range (°C): -1.617 - 20.470

Nitrate (umol/L): 0.877 - 44.345

Salinity (PPS): 23.803 - 36.380

Oxygen (ml/l): 0.853 - 8.398

Phosphate (umol/l): 0.203 - 3.128

Silicate (umol/l): 1.228 - 115.593
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

"Typically on mud bottoms." (Lambert, Austin 2007)

Public Domain

Browne, Joy

Source: EOL Interns LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

"This opportunistic carnivore feeds on small benthic invertebrates, carrion and detritus, but it has also been observed attempting to catch larger organisms near the bottom. The distal two-thirds of the arms are raised and ready to encircle prey, such as myctophid fish, euphausids and small squid, that blunder into the ocean bottom, if a brittle star captures an animal, others join in to share the meal." (Lambert, Austin 2007)

Public Domain

Browne, Joy

Source: EOL Interns LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Breeding

Probably ophiopluteus larva
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

"This species has seperate sexes. In the San Juan Islands, ripe specimens collected from March to June will spawn in the lab." (Lambert, Austin 2007)

Public Domain

Browne, Joy

Source: EOL Interns LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ophiura sarsii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GACCCTATATTTAATATTTGGTGCTTGAGCTGGAACTGTTGGAACGGCTATGAGAAACATAATTCGAGTTGAGTTGTCACAGCCAGGATCCCTGATACAAAAAGATCAAACGTATAACGTAATAGTGACGGCACACGCCTTTATAATGATTTTTTTTATGGTGATGCCTATAATGATAGGAGGATTTGGTAACTGATTAGTTCCGCTTATGATCGGAGCACCAGACATGGCTTTTCCCCGGATGAAAAAAATGAGATTTTGGTTAATACCCCCTTCTTTTTTATTATTAGTAGCTTCTGCAGGAAAAGAGAGCGGTGTAGGAACAGGGTGAACGGTCTATCCCCCATTATCCGGACCAGTTGCTCACGCTGGTGGCTGTGTAGATTTAGCTATATTTTCTCTTCACCTAGCTGGTGCTTCATCAATAATGGCATCAATTAACTTTATTACTACTATTATTAATATGCGAGCGCCAGGAATGACAATGGATCGAACTCCTTTATTTGTTTGGTCCATTCTAATTACAACATTTCTTTTGCTACTCTCATTGCCTGTTTTAGCCGGAGCTATTACTATGTTATTAACAGACCGGAAAATTAAAACATCTTTCTTCGACCCAACAGGAGGAGGTGACCCTATTTTATTCCAACACCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ophiura sarsii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!