Overview

Brief Summary

Biology

O. albida has separate sexes, external fertilization and pelagic larvae. The maximum age is estimated at 3 years. This shortlived species shows a relatively fast-growing strategy. O. albida may be particularly vulnerable to predation. It shows a high reproductive effort, thus maintaining the populations (Wolff, 1973; Fish & Fish, 1989; Gage, 1990). The species moves freely on the sediment (Mortensen, 1927). Small invertebrates, particularly polychaetes, bivalve mollucs and crustaceans, comprise the main food of Ophiura spp. There is evidence that scavenging and surface deposit feeding are also fairly frequent (Wolff, 1973; Warner, 1982; Fish & Fish, 1989). Young stages of trematodes and nematodes can be found in the body cavity of this brittle star (Mortensen, 1927).
  • Holtmann, S.E.; Groenewold, A.; Schrader, K.H.M.; Asjes, J.; Craeymeersch, J.A.; Duineveld, G.C.A.; van Bostelen, A.J.; van der Meer, J. (1996). Atlas of the zoobenthos of the Dutch continental shelf. Ministry of Transport, Public Works and Water Management: Rijswijk, The Netherlands. ISBN 90-369-4301-9. 243 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description

 A red-brown brittlestar with a disc up to 15 mm in diameter, smaller than Ophiura ophiura. The arms are about four times the diameter of the disc which is covered, on the upper surface, with coarse scales. The arm spines lie almost flat against the arms.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

A small brittle star with short, tapered, straight arms. The body and arms are red-brown in colour and there are two white marks at the base of each arm. There are arm combs of 8-12 short papillae and 3 arm spines. Disc to 15mm., arms 4x disc diameter. Ophiura robusta is similar in colouring and may occur with Ophiura albida on NE coasts of Scotland. Ophiura robusta has feebly developed arm combs.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

From about 10 to more than 200 m depth, common on sand, muddy sand and fine gravel, all round the British Isles
  • Southward, E.C.; Campbell, A.C. (2006). [Echinoderms: keys and notes for the identification of British species]. Synopses of the British fauna (new series), 56. Field Studies Council: Shrewsbury, UK. ISBN 1-85153-269-2. 272 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In both periods Ophiura albida was widely spread across the Belgian part of the North Sea and was only absent in the eastern coastal zone. The species was found in relatively high densities (1976-1986 period: maximum 100 ind./m2; 1994-2001 period: maximum 900 ind./m2).
  • Degraer S., J. Wittoeck, W. Appeltans, K. Cooreman, T. Deprez, H. Hillewaert, K. Hostens, J. Mees, E. Vanden Berghe & M. Vincx (2006). The macrobenthos atlas of the Belgian part of the North Sea. Belgian Science Policy. D/2005/1191/3. ISBN 90-810081-6-1. 164 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common all round the British Isles.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Description

Brittle stars consist of a central disk clearly separated from the slender, very agile and very strong arms. Ophiura albida is very similar to Ophiura ophiura and can only be distinguished from this species by the absence of pores between the arm plates. The top is reddish to orange-brown; the bottom side is dirty white.
  • Degraer S., J. Wittoeck, W. Appeltans, K. Cooreman, T. Deprez, H. Hillewaert, K. Hostens, J. Mees, E. Vanden Berghe & M. Vincx (2006). The macrobenthos atlas of the Belgian part of the North Sea. Belgian Science Policy. D/2005/1191/3. ISBN 90-810081-6-1. 164 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Morphology

O. albida has a disk with rather coarse scales. The diameter of the disk can be up to 15 mm. The arms are about four times the diameter of the disk. The dorsal and ventral arm plates have a convex outer edge. The mouth shield is small, approximately one-third of the disk radius. In contrast to O. texturata (q.v.) there are no pores present between the lower arm plates. The colour of the dorsal surface usually is reddish-brown, that of the radial shields whitish (Mortensen, 1927; Southward, 1972; Gage, 1990; Hayward & Ryland, 1990).
  • Holtmann, S.E.; Groenewold, A.; Schrader, K.H.M.; Asjes, J.; Craeymeersch, J.A.; Duineveld, G.C.A.; van Bostelen, A.J.; van der Meer, J. (1996). Atlas of the zoobenthos of the Dutch continental shelf. Ministry of Transport, Public Works and Water Management: Rijswijk, The Netherlands. ISBN 90-369-4301-9. 243 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Ophiura albida prefers fine to coarse-grained sediments (median grain size 150-650 µm) without any preference for a particular median grain size. The species furthermore prefers sediments with a low to medium mud content (maximum 40%).
  • Degraer S., J. Wittoeck, W. Appeltans, K. Cooreman, T. Deprez, H. Hillewaert, K. Hostens, J. Mees, E. Vanden Berghe & M. Vincx (2006). The macrobenthos atlas of the Belgian part of the North Sea. Belgian Science Policy. D/2005/1191/3. ISBN 90-810081-6-1. 164 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

O. albida lives in areas with a variety of sand and muddy sand deposits.
  • Holtmann, S.E.; Groenewold, A.; Schrader, K.H.M.; Asjes, J.; Craeymeersch, J.A.; Duineveld, G.C.A.; van Bostelen, A.J.; van der Meer, J. (1996). Atlas of the zoobenthos of the Dutch continental shelf. Ministry of Transport, Public Works and Water Management: Rijswijk, The Netherlands. ISBN 90-369-4301-9. 243 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1555 specimens in 1 taxon.
Water temperature and chemistry ranges based on 864 samples.

Environmental ranges
  Depth range (m): 0 - 2966
  Temperature range (°C): -0.912 - 13.949
  Nitrate (umol/L): 0.693 - 16.868
  Salinity (PPS): 31.635 - 38.491
  Oxygen (ml/l): 4.348 - 7.328
  Phosphate (umol/l): 0.031 - 1.057
  Silicate (umol/l): 1.488 - 13.493

Graphical representation

Depth range (m): 0 - 2966

Temperature range (°C): -0.912 - 13.949

Nitrate (umol/L): 0.693 - 16.868

Salinity (PPS): 31.635 - 38.491

Oxygen (ml/l): 4.348 - 7.328

Phosphate (umol/l): 0.031 - 1.057

Silicate (umol/l): 1.488 - 13.493
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 Found sublittorally on a variety of soft substrata but mainly fine muddy sands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lives on the surface of muddy sand and muddy gravel or on silty surfaces of rocks or boulders.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Breeding

Ophiopluteus larva. Summer
  • Southward, E.C.; Campbell, A.C. (2006). [Echinoderms: keys and notes for the identification of British species]. Synopses of the British fauna (new series), 56. Field Studies Council: Shrewsbury, UK. ISBN 1-85153-269-2. 272 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ophiura albida

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGAAAACATATAGATCAAAATTTAATTTATATATTAGCCGCTGATTTTTTTCAACTAAACACAAGGACATTGGAACTTTATATTTAATTTTTGGTGCATGAGCTGGTACAGTGGGAACTGCCATGAGAAAAATTATTCGAGTAGAATTATCACAACCGGGATCTCTTATACAGAAAGATCAAACTTATAAAGTTATTGTAACAGCGCATGCTTTCATTATGATCTTTTTTATGGTGATGCCTATAATGATAGGAGGATTTGGAAATTGACTAGTGCCTTTAATGATTGGAGCTCCTGACATGGCCTTCCCTCGAATGAAAAACATGAGTTTTTGATTAATTCCCCCTTCATTTCTTCTTCTAGTTGCCTCAGCTGGTAATGAAAGAGGGGTGGGAACAGGTTGAACAGTTTATCCCCCTCTTTCAGGTCCAGTGGCCCATGCTGGTGGATGTGTTGATTTAGCAATTTTTTCTTTACATCTAGCTGGTGCTTCCTCAATAATGGCCTCAATTAACTTTATAACTACTATAATTAATATGCGAGCTCCTGGGATGACAATGGATCGTACTCCTCTATTTGTTTGATCTATTTTAATAACAACTTTCTTATTATTGTTATCACTCCCGGTACTAGCAGGAGCAATTACTATGTTATTAACTGATCGTAATATTAATACTTCATTTTTTGACCCGACTGGAGGGGGAGACCCAATTTTATTTCAACACTTATTCTGGTTTTTTGGCCATCCTGAAGTTTATATTTTAATATTACCAGGTTTTGGTATAATTTCCCATGTAGTAACTAATCGCACAGGAAAGCAACAACCATTTGGTTATCTAGGTATGATGTACGCCATGATTACAATTGGTATTTTAGGGTTTATTGTATGGGCTCATCATATGTTTACTGTGGGTCTTGATGTTGATACGCGAGCTTATTTTACCGCTGCAACAATGATTATTGCTATTCCTACAGGTGTTAAGGTATTTAGGTGATTAGCGACACTTCAAGGTGTACCTTTTAATATCAAAAAAGCTCATCCTTCTCTAATGTGAGCAATTGGGTTTATTTTCCTTTTTACTGTGGGAGGTCTTACTGGTATAGTTTTATCTAATTCATCATTAAAAGTAGCCCTTCATGACACGTACTATGTAACTGCTCACTTTCATTATGTTTTATCAATGGGAGCAGTATTTGCTATATTTAGGGGATTCAACCACTGATTTCCCTTATTTACAGGAGCTAAATTAGACCACACTAGAGCCACAACTCATTTTATTCTTATGTTTATTGGTGTTAACTTGACATTTTTTCCTCAGCATTTCCTAGGATTAGCGGGAATGCCACGACGATATTCTGATTACCCAGATGCATTTACTTTTTGAAAAACAGTTTCTTCTTTAGGCTCCCTATTATCATTTATTGGTACCATAGGTTTTCTCACTATTGTAGCGCTTTCTTTAAGCAATAATAAAATTAATACTAGAACTAATGAAGCTATTTCTAAATTAGAATGACATTATCCTATTTACCCCCCTCAAGAACATACATTTAAAGAAATGCCTATCTCATGAAATAGAATTAATAAGAGAATAATTTCATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ophiura albida

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Ophiura albida

Ophiura albida is a species of brittle star in the order Ophiurida. It is typically found on the seabed in the north eastern Atlantic Ocean and in the Mediterranean Sea and is sometimes known as the serpent’s table brittle star.[2]

Contents

Description

Ophiura albida has a central disc reaching a diameter of about 1.5 centimetres (0.6 in) and five arms up to 6 centimetres (2.4 in) long. The disc is flattened and the upper surface is covered in small plates. These are mostly brick red but the plates at the edge of the disc close to where the arms are attached are white. The arms are slender and fragile, segmented and gradually tapering. The plates on the upper and lower sides have convex edges. Each segment has three short spines which lie flat on the surface and there are small pores between the plates. This latter fact helps to distinguish this species from the otherwise very similar Ophiura ophiura. The underside of the disc is a pale colour and has a central mouth with five large plates modified as jaws and fringed with teeth.[1][2][3]

Distribution and habitat

Ophiura albida is found at depths down to about 200 metres (660 ft), or 850 metres (2,790 ft) according to one authority. Its range extends from Norway to the Mediterranean Sea and the Azores. It occurs on the seabed on soft substrates including coarse sand, fine sand, gravel and muddy sand.[1][3] It is common round the coasts of the British Isles and has occurred at densities as great as 900 per 1 square metre (11 sq ft).[1]

Biology

Ophiura albida is a predator and scavenger and feeds on such small invertebrates as polychaete worms, crustaceans and bivalve molluscs.[1] In the Baltic Sea it is the favourite food of the starfish Luidia sarsi and is chosen in preference to other brittle stars.[4] In the Irish Sea it is eaten along with the common brittle star (Ophiothrix fragilis) by the fast-moving seven armed starfish (Luidia ciliaris).[5]

Individuals of this species are either male or female. Fertilisation is external and the larvae are planktonic. It is a fast-growing brittle star and is not thought to live for more than three years.[1]

References

  1. ^ a b c d e f g Stöhr, Sabine (2012). "Ophiura albida Forbes, 1839". World Register of Marine Species. Retrieved 2012-12-04. 
  2. ^ a b Wilson, Emily (1999). "Serpent’s table brittlestar - Ophiura albida". Marine Life Information Network. Marine Biological Association of the United Kingdom. Retrieved 2012-12-04. 
  3. ^ a b "Ophiura albida". Macrobenthos of the North Sea - Echinodermata. Marine Species Identification Portal. Retrieved 2012-12-04. 
  4. ^ Fenchel, Tom (1965). "Feeding biology of the sea-star Luidia sarsi Düben & Koren". Ophelia 2 (2): 223–236. doi:10.1080/00785326.1965.10409601. 
  5. ^ Brun, Einar (1972). "Food and Feeding Habits of Luidia ciliaris Echinodermata: Asteroidea". Journal of the Marine Biological Association of the United Kingdom 52 (1): 225–236. doi:10.1017/S0025315400018671. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!