Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

Ecology

Ecology: benthic, continental shelf, continental slope, abyssal. General distribution: temperate, circumglobal (except central Pacific Ocean and pole areas), depth range 130-4000 m. (Rowe & Gates, 1995). Also previously recorded in Australia (Rowe & Gates, 1995).
  • Clark, A.M. and J. Courtman-Stock. (1976). The echinoderms of southern Africa. Publ. No. 766. British Museum (Nat. Hist), London. 277 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

This species is luminescent emitting a blue light.
  • Mallefet, J. 2009. Echinoderm bioluminescence: Why, when and how do so many ophiuroids glow? Bioluminescence in Focus - A Collection of Illuminating Essays. Meyer-Rochow, V.B. (ed.), Rsearch Singpost, Trivandrum, India, 1-17.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Bay of Fundy to Cape Cod
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General distribution: temperate, circumglobal (except central Pacific Ocean and the polar regions).

Depth range 130-4000 m. (Rowe & Gates, 1995).

In Panama this species was collected by the R. V. Albatross from southeast of Punta Mala, Azuero Peninsula (USNM 39771, USNM 19509, USNM 19510; Centroid Latitude: 7.2500, Centroid Longitude: -79.6000), eastern Pacific, from a depth range of 1866 to 2323 m.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Coppard , Simon

Source: The Echinoderms of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

References and links

Wyville-Thomson, C. (1873). The Depths of the Sea. (Macmillan and Co.: London): 1-527.

Clark, A. M. and J. Courtman-Stock. (1976). The echinoderms of southern Africa. Publ. No. 766. British Museum (Nat. Hist), London. 277 pp.

Gosner, K.L. 1971. Guide to identification of marine and estuarine invertebrates: Cape Hatteras to the Bay of Fundy. John Wiley & Sons, Inc. 693 p.

Hansson, H.G. (2001). Echinodermata, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 336-351.

Barcode of Life

GenBank

World Ophiuroidea Database

LSID urn:lsid:marinespecies.org:taxname:124895


Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Coppard , Simon

Source: The Echinoderms of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Synonymised taxa

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Coppard , Simon

Source: The Echinoderms of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type material

Syntypes: held at the Natural History Museum, London.

Type locality: off the coast of Ireland (Rowe & Gates, 1995).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Coppard , Simon

Source: The Echinoderms of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 517 specimens in 1 taxon.
Water temperature and chemistry ranges based on 425 samples.

Environmental ranges
  Depth range (m): 62 - 4829
  Temperature range (°C): 1.605 - 8.454
  Nitrate (umol/L): 14.244 - 44.880
  Salinity (PPS): 34.419 - 35.569
  Oxygen (ml/l): 0.500 - 6.587
  Phosphate (umol/l): 1.071 - 3.294
  Silicate (umol/l): 10.923 - 174.224

Graphical representation

Depth range (m): 62 - 4829

Temperature range (°C): 1.605 - 8.454

Nitrate (umol/L): 14.244 - 44.880

Salinity (PPS): 34.419 - 35.569

Oxygen (ml/l): 0.500 - 6.587

Phosphate (umol/l): 1.071 - 3.294

Silicate (umol/l): 10.923 - 174.224
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Ecology

Benthic, continental shelf, continental slope, abyssal.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Coppard , Simon

Source: The Echinoderms of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ophiomusium lymani

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TACCCTATATCTTATCTTTGGTACTTGAGCGGGCACCGTAGGAGTAGCAATGAGAAATATAATCCGAGTAGAGCTATCCCAGCCAGGCTCACTTATACAAGACGACCAAACATATAAAGTAATGGTAACATCTCATGCTCTAATAATGATATTTTTTATGGTAATGCCCATAATGATAGGAGGATTTGGAAATTGGCTTACACCTTTAATGTTGGGGGCACCCGATATGGCTTTCCCTCGTATGAAAAAAATGAGCTTTTGATTAATCCCCCCTGCATTTCTCCTTTTAACAGCCTCCGCTGCAAATGAAGGAGGTGTAGGAACCGGTTGAACTATTTATCCCCCTCTCTCTGGTCCAGTTGCTCATGGAGGGGGATGCGTCGACCTAGCTATTTTCTCTATTCATCTAGCCGGTGCATCATCTATAATGGCCTCCATAAAATGTATCTCTACTATTATTAACATGCGAGCATCTGGGATGTTTATGGACCGAGCTCCCTTATTTATTTGATCTATTTTAATTACAACATTCCTTTTATTACTTTCCCTTCCAGTTTTAGCCGGAGCTATTACCATGCTACTAACTGACCGGAATATAAAAACTTCATTCTTTGACCCTACTGGAGGAGGAGACCCCA--CTATTCCAACACCTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ophiomusium lymani

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!