Overview

Distribution

Geographic Range

Diadema antillarum is found in the shallow waters of the Atlantic Ocean, in the Bahamas, and the Western Atlantic from eastern Florida to Brazil. In the Eastern Atlantic D. antillarum is found in Madeira, the Gulf of Guinea, and the Canary, Cape Verde, and Annabon islands.

Biogeographic Regions: atlantic ocean (Native )

  • Hendler, G., J. Miller, D. Pawson, P. Kier. 1995. Sea Stars, Sea Urchins, and Allies: Echinoderms of Florida and the Caribbean. Washington: Smithsonian Institution Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In Panama this species been collected in the Caribbean from:

-Galeta Island (USNM E 26602, USNM E 26687, USNM E 28260, USNM E 38607; Centroid Latitude: 9.4067, Centroid Longitude: -79.8667)

Portobelo (USNM E 11402, USNM E 27448)

-Limon Bay, Colon (USNM 39448, USNM E 26606)

-3.5 miles North of the Piedras River (USNM E 18817)

-Miria Island, San Blas (USNM E 26686)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Coppard , Simon

Source: The Echinoderms of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Diadema antillarum is a regular (round) urchin, and displays the pentamerism of echinoderms. Mature individuals of D. antillarum can reach up to 500 mm in diameter. Diadema antillarum has thin spines that range from 300-400 mm in length and can be up to four times the diameter of the test (skeleton formed inside the body). The spines are thin, hollow, and break easily. The test is rigid and there is a reduced amount of soft tissue in the body wall as compared to other species in the family Diadematidae.

The test and spines of a mature adult are typically black, but lighter colored spines may be intermixed, and in rare cases the urchin will be almost entirely white. The spines of juveniles are always banded with black and white. When the urchin dies, the spines falls off and the test remains.

At the base of the urchin are branched tentacles called tube feet, which help in gathering food, respiration, locomotion, and mucous production.

Other Physical Features: ectothermic ; heterothermic ; radial symmetry

  • Nichols, D., J. Cooke. 1971. The Oxford Book of Invertebrates. Oxford: Oxford University Press.
  • Banister, K., A. Campbell. 1985. The Encyclopedia of Aquatic Life. New York: Facts of File Publishing.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

References and links

Mortensen, T. (1940). A monograph of the Echinoidea 3(1). Aulodonta. Copenhagen. 370 pp., 196 figures, 77 pls, pages: 269-275.

Lessios, H. A. (1988). Population dynamics of Diadema antillarum (Echinodermata: Echinoidea) following mass mortality in Panamá. Marine Biology 99: 515-526.

Lessios, H. A., Robertson, D. R. & Cubit, J. D. (1984). Spread of Diadema mass mortality through the Caribbean. Science 226: 335-337.

Lessios, H.A., Kessing, B.D. & Pearse, J.S. (2001). Population structure and speciation in tropical seas: global phylogeography of the sea urchin Diadema. Evol. 55: 955-975.

Coppard, S. E. & Campbell, A. C. (2004). Taxonomic significance of spine morphology in the echinoid genera Diadema and Echinothrix. Invertebrate Biology, 123 (4), 357-371.

Coppard, S. E. & Campbell, A. C. (2006a). Taxonomic significance of test morphology in the echinoid genera Diadema Gray, 1825 and Echinothrix Peters 1853 (Echinodermata). Zoosystema 28(1), 93-112.

Coppard, S. E. & Campbell, A.C. (2006b). Systematic significance of tridentate pedicellariae in the echinoid genera Diadema and Echinothrix. Invertebrate Biology 125(4), 363-378.

Barcode of Life

GenBank

The Echinoid Directory

World Echinoidea Database

LSID urn:lsid:marinespecies.org:taxname:124332
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Coppard , Simon

Source: The Echinoderms of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Synonymised taxa

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Coppard , Simon

Source: The Echinoderms of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Diadema antillarum favors quiet waters, and is found most often in coral reefs. This species can also be found in turtle grass beds and on rock bottoms.

Range depth: 0 to 400 m.

Habitat Regions: tropical ; saltwater or marine

Aquatic Biomes: reef

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 96 specimens in 3 taxa.
Water temperature and chemistry ranges based on 64 samples.

Environmental ranges
  Depth range (m): 1 - 1814
  Temperature range (°C): 4.280 - 27.802
  Nitrate (umol/L): 0.114 - 22.294
  Salinity (PPS): 34.964 - 36.548
  Oxygen (ml/l): 4.284 - 4.984
  Phosphate (umol/l): 0.055 - 1.545
  Silicate (umol/l): 1.019 - 28.202

Graphical representation

Depth range (m): 1 - 1814

Temperature range (°C): 4.280 - 27.802

Nitrate (umol/L): 0.114 - 22.294

Salinity (PPS): 34.964 - 36.548

Oxygen (ml/l): 4.284 - 4.984

Phosphate (umol/l): 0.055 - 1.545

Silicate (umol/l): 1.019 - 28.202
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Diadema antillarum grazes on the algal turf of coral reefs primarily during the night. Foods eaten include algal turf, young corals and zoanthids.

Animal Foods: aquatic or marine worms; cnidarians; other marine invertebrates; zooplankton

Plant Foods: algae

Primary Diet: carnivore (Eats non-insect arthropods, Eats other marine invertebrates); herbivore (Algivore); omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Diadema antillarum feeds on the algal turf of the coral reefs. The algal turf grows rapidly, and without the urchin's control, can destroy the reefs. Diadema antillarum clears the reefs, making room for coral larvae to settle and grow. However, the urchin actually wears away at the calcium carbonate of the reef, too.

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

The spines of Diadema antillarum are brittle and will fragmentize if wounded. The pieces are difficult to remove, and often cause infections as they carry bacteria. The mucous coating of the spines, normally used to kill organisms that live in the spines, carries a mild poison that also aids in deterring smaller predators. Diadema antillarum has been observed to gather in groups as an added protection.

Known Predators:

  • queen triggerfish (Balistes vetula)
  • Caribbean spiny lobsters (Panularis argus)
  • Caribbean helmets (Cassis turberosa)
  • two species of toadfish (Antennariidae)

  • Carson, R. 1955. The Edge of the Sea. Boston: Houghton Mifflin Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Diadema antillarum has a highly developed light sensitivity. When a shadow appears, the urchin waves its spines in the direction of the shadow and moves away from the shadow, often into a more protected area. In this sense, D. antillarum can almost 'see' predators. It is not known how individuals communicate with each other to aggregate.

Communication Channels: chemical

Other Communication Modes: photic/bioluminescent

Perception Channels: visual ; tactile ; chemical

  • Waller, G. 1996. SeaLife: A Complete Guide to the Marine Environment. Washington D.C.: Smithsonian Institution Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

The fertilized egg has two forms: the blastula and the gastrula. These swim close to the surface of the water with the aid of cilia, and can be dispersed quite far, depending on currents. These larvae are known as the echinopluteus, and can remain in the larval stage for an average of 4-6 weeks. As the larvae mature, a vestibule is created in what will be the oral side of the urchin. Tentacles grow from this opening, on which suction areas eventually emerge. When the tentacles have suckers, they are primary poda, which serve as locomotive tools when the larva sinks to the ocean floor. At this point the skeletal plates begin to develop. When the 5 ambulical plates are developed and the terminal plate lies next to the genital plates, the urchin is fully developed, though it will continue to grow for the rest of its life.

Development - Life Cycle: metamorphosis

  • Grzimek, B. 1972. Grzimek's Animal Life Encyclopedia. New York: Van Norstand Reinhold Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The lifespan of D. antillarum is closely related to temperatures and food availability. Populations in warmer climates tend to have a quicker rate of development and shorter lifespan than those in colder climates.

Average lifespan

Status: wild:
6 years.

Typical lifespan

Status: wild:
4 to 8 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Some populations of D. antillarum have been observed to congregate during their spawning season. There is no mating of individuals as fertilization and gestation occur in the open water.

The spawning of D. antillarum appears to be connected to the lunar calendar. During the summer season, the egg and sperm are released once during each lunar month. This spawning period is dependant upon temperature; populations in different hemispheres may spawn at different times depending on when the warm season occurs.

The egg and sperm are released into the water where they are fertilized and develop into the larval echinopluteus. Egg size has also been observed to change during the month. Spawning occurs when the eggs are largest.

Breeding interval: Spawning is temperature dependent.

Breeding season: In summer, eggs and sperm are released each lunar month.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External )

There is no parental involvement post-spawning.

Parental Investment: pre-fertilization (Provisioning)

  • Anonymous, 1967. The Larousse Encyclopedia of Animal Life. Verona, Italy: McGraw-Hill Book Company.
  • Hendler, G., J. Miller, D. Pawson, P. Kier. 1995. Sea Stars, Sea Urchins, and Allies: Echinoderms of Florida and the Caribbean. Washington: Smithsonian Institution Press.
  • Grzimek, B. 1972. Grzimek's Animal Life Encyclopedia. New York: Van Norstand Reinhold Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Diadema antillarum antillarum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Diadema antillarum antillarum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Diadema antillarum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TACTCTTTATTTAATCTTTGGAGCTTGGGCCGGGATGGTCGGAACCGCCATGAGAGTAATTATCCGAGCTGAATTAGCTCAGCCGGGATCTCTCCTAAAAGACGACCAAATCTATAATGTAGTAGTAACCGCCCACGCCTTAGTGATGATCTTTTTCATGGTCATGCCAATAATGATTGGTGGGTTCGGAAACTGGCTGATCCCGTTAATGATAGGGGCACCAGACATGGCTTTTCCTCGGATGAACAAAATGAGTTTCTGGTTAGTGCCCCCTTCCTTTATTCTACTACTAGCTTCTGCCGGAGTAGAAAGAGGGGCAGGCACAGGATGAACCATTTATCCCCCACTCTCTAGCAATATTGCTCACGCCGGTGGATCCGTGGACTTAGCTATCTTTTCCCTTCACCTAGCCGGTGCTTCTTCGATTCTTGCTTCTATTAATTTTATTACTACTATCATCAAAATGCGAACCCCTGGGATGTCTTTTGACCGCTTACCTCTATTTGTCTGATCTGTTTTTATCACCGCCTTCCTACTCCTACTTTCTCTCCCAGTTTTAGCCGGAGCAATTACAATGCTCTTAACTGACCGAAAAATCAACACTACATTTTTTGACCCTGCAGGAGGAGGAGATCCCATCCTGTTCCAGCACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Diadema antillarum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

The spines of D. antillarum are very sharp and can easily pierce skin, shoes, and wetsuits. Contact with a spine is not extremely painful, but the shattering of the spine leaves organic material in the wound that can cause intensely painful infections. The poisonous mucous seems to have very little effect on humans.

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The gonads of sea urchins are considered a delicacy in many coastal regions, but D. antillarum is not one of the more preferred species.

Sea urchin eggs are used extensively in embryological research.

Positive Impacts: food ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Diadema antillarum

Diadema with unusual grey spines at Snapper Ledge

Diadema antillarum, also known as the lime urchin, black sea urchin or the long-spined sea urchin,[2] is a species of sea urchin in the Family Diadematidae.

This sea urchin is characterized by its exceptionally long black spines.

It is the most abundant and important herbivore on the coral reefs of the western Atlantic and Caribbean basin. When the population of these sea urchins is at a healthy level, they are the main grazers which prevent algae overgrowth of the reef.

Anatomy[edit]

Diadema antillarum has a test, or "shell," similar to most other sea urchins. What distinguishes the Diadema is the length of its spines. Most sea urchin spines are 1–3 cm, but the spines in this species are usually 10–12 cm in length, and can grow as long as 30 cm in very large individuals.

Life habits[edit]

This species usually lives at 1–10 metres in depth on coral reefs. They will often lodge themselves in a crevice, so that only their spines can be seen, but individual urchins who can't find a suitable crevice will live in more exposed situations. Individuals that have been able to find a crevice usually will roam about one metre from their crevice at night during feeding. Diadema is very sensitive to light, and will often pick its crevice or resting place based on how much shade there is.

Diadema mostly eat algae, and sometimes seagrass. Starving urchins have been known to become carnivorous.

Ecological Importance[edit]

Diadema antillarum is still, in some tropical areas, one of the most abundant, widespread, and ecologically-important shallow-water sea urchins. It is found in the tropical Western Atlantic Ocean, including the Caribbean Sea, Gulf of Mexico and the northern and eastern coasts of South America (as far south as Brazil). It is also found in the East Atlantic at the Canary Islands. This species is ecologically important because it consumes algae that can otherwise grow to such an extent that they can smother coral reefs. They live in holes that are in the reef.

Die-off of urchins[edit]

In 1983, throughout the Caribbean faunal zone as far south as South America and north to the Bahamas, Diadema antillarum underwent mass mortality, with more than 97% of the urchins dying.[3] Since this time some Caribbean reefs have been overgrown by foliose macroalgae. This inhibits coral growth and has further compounded the ongoing decline of scleractinian corals. It also has an overall negative effect on coral reef resilience, which encompasses the ability of a system to resist and recover from changes stemming from perturbation events. Recent studies done in Discovery Bay, Jamaica,[4] and other locations[citation needed] appear to show a massive comeback of Diadema, and great regeneration of the reefs.

Human relevance[edit]

When the sea urchins died due to an unknown disease, the biodiversity of the marine life of the coral reefs suffered a great deal. The resulting lush algae growth stunted and even reversed the development of coral, and the fish and other animals living on the reefs declined in numbers due to less food and shelter.

The reduced biodiversity of the coral reefs affected tourism in several small countries, which depended on the natural beauty of their reefs to help attract visitors, and because tourism was a major part of the income for these countries, the decreased flow of guests stressed their economy.

Low-density populations, predators, and waves from high-powered storms tends to impede the repopulation of Diadema antillarum. In the fertilization process, male and female urchins excrete fluid to alert other urchins to respond by releasing their eggs and sperm in mass reproduction. With more gametes available, there is a higher chance of fertilization. However, in areas of low-population, a few sea urchins may not be enough to initiate fertilization. After fertilization, there is still a high chance that predators may consume the vulnerable juveniles. Because of the movement of water in powerful storms, urchins can get swept away from their habitat and expire. It is possible to aid the increase in population growth of the urchin with more research and volunteers.

Research on re-population of the species[edit]

Research on the species Diadema antillarum is still in its early stages. The urchins can be grown in laboratories and then relocated. Returning the mature individuals into the wild can have a positive effect on the urchin density of the reef. The increase in population can also be aided by the artificial building of reefs: material such as concrete can encourage the growth of coral, and provide more niches for the urchins to hide from predators such as larger fish.

When there are still some areas of high-density urchins, it is possible to relocate urchins to other, low-density reefs. With these methods and the help of volunteer workers, it seems that the shift back to coral-dominated reefs and away from algae-dominated reefs is possible.

When re-locating Diadema it is necessary to remove most mature algae from the re-location area since there are toxins in mature algae that kills the Diadema.

References[edit]

  1. ^ a b Kroh, Andreas (2013). "Diadema antillarum Philippi, 1845". In A. Kroh & R. Mooi. World Echinoidea Database. World Register of Marine Species. Retrieved 2013-11-22. 
  2. ^ Long-spined Sea Urchin
  3. ^ Osborne, Patrick L. (2000). Tropical Ecosystem and Ecological Concepts. Cambridge: Cambridge University Press. p. 464. ISBN 0-521-64523-9. 
  4. ^ Edmunds, Peter J.; Robert C. Carpenter (April 2001). "Recovery of Diadema antillarum reduces macroalgal cover and increases abundance of juvenile corals on a Caribbean reef". PNAS 98 (9): 5067–5071. doi:10.1073/pnas.071524598. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!