Overview

Brief Summary

Fossil species

recent & fossil

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 75 specimens in 1 taxon.
Water temperature and chemistry ranges based on 38 samples.

Environmental ranges
  Depth range (m): 5.5 - 37
  Temperature range (°C): 16.269 - 16.269
  Nitrate (umol/L): 1.692 - 1.692
  Salinity (PPS): 37.969 - 37.969
  Oxygen (ml/l): 5.382 - 5.382
  Phosphate (umol/l): 0.229 - 0.229
  Silicate (umol/l): 1.778 - 1.778

Graphical representation

Depth range (m): 5.5 - 37
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Arbacia lixula

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGCAACTAAGACGATGATTATTTTCTACAAACCATAAGGATATTGGAACTCTTTATCTTATCTTTGGAGCTTGAGCAGGCATGGTAGGAACAGCCATGAGAGTTATTATTCGAGCTGAACTTGCTCAACCCGGTTCTCTGCTTCAAGATGACCAAATTTACAATGTAGTAGTTACTGCACTTGCCCTCGTAATGATTTTTTTCATGGTAATGCCAATTATGATCGGGGGATTTGGTAACTGATTAATCCCCCTAATGATTGGTGCCCCCGATATGGCTTTCCCTCGAATGAACAATATGAGCTTTTGATTAATTCCTCCTTCTTTTATCCTACTATTAGCTTCTGCCGGGGTAGAAAGAGGAGCAGGAACAGGGTGAACCATTTATCCTCCCCTATCAAGTAAAATAGCACATGCGGGTGGATCTGTAGATCTTGCTATTTTTTCTCTACACTTGGCCGCTGCCTCTTCCATCTTAGCCTCAATAAATTTTATAACTACTATTATAAATATGCGAACGCCAGGGGTCTCTTTTGACCGTTTACCCCTTTTTGTGTGATCCGTATTCATAACAGCTTTTCTTTTGTTATTATCTCTACCAGTTCTAGCAGGGGCTATAACTATGTTATTAACAGACCGAAATATTAAAACCACCTTTTTTGACCCAGCAGGTGGAGGAGACCCTATTTATTTCCAACATCTATTTTGATTCTTTGGACACCCTGAAGTATATATTTTAATCCTTCCTGGCTTTGGAATGATTTCCCACGTAATAGCTCATTATGCTGGGAAGAGAGAACCATTTGGATATCTAGGAATGGTGTATGCTATGATTGCAATTGGAGTACTAGGATTCCTAGTTTGAGCCCACCACATGTTTACTGTCGGAATGGACGTAGATACCCGAGCCTATTTTACAGCAGCGACTATGATTATAGCTGTCCCTACCGGGATTAAGGTATTTAGCTGAATGGCAACCCTCCAAGGGTCTAATTTACAGTGGAGACCCCCTCTTTTATGAGCACTTGGATTTGTTTTTCTCTTTACACTAGGGGGATTAACAGGTATTCTATTAGCTAACTCCTCTATAGACGTGGTACTACACGATACCTACTATGTAGTTGCCCACTTTCACTATGTTCTTTCAATGGGAGCAGTCTTCGCTATTTTTGCTGGCTTTACTCACTGATTTCCACTATTCTCCGGATACAGCTTCCACCCACTTTGAAGTAAGGTACAGTTTTATATGTCATTGGAGTTAATCTTAACCTTTTTCCCCCAACACTTTTTAGGCCTCGCAGGAATGCCTCGTCGATACTCTGACTACCCAGATGCCTACACCTTATGAAATACAATTTCATCTATTGGCTCTACTATTTCGCTCGTTGAATTCCTGTTCTTTCTCTTTTTAATCTGAGAACCTTTCGCCTCAAAACGAGAAGGAATTTCTCCAGAATTCTCTCACGCATCACTAGAGTGGCAATATGCCTCTTTTCCCCCTTCCCACCATACCTTTGATGAAACACCTTCAACCGTTATTTTTATAAAGTAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Arbacia lixula

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Arbacia lixula

The Black Sea Urchin, Arbacia lixula is a Sea Urchin found on the coast of the Mediterranean Sea and Macaronesian Islands (Azores, Madeira, Canary Islands), and less commonly, on the Atlantic coast of Western Africa and the Brazilian coast. It is found typically at shallow waters, at depths from 0 to 30 m, in rocky shores. It has a good resistance to hydrodynamism due to a good attachment strength to rocks.

This species feeds mainly on crustose red algae and small filamentous algae. In a marine reserve in the Mediterranean, its population increased by a factor of over ten between 1983 and 1992, from eight individuals per square metre to a hundred individuals. It is thought that higher sea water temperatures favour this species. When it was excluded from an area of the reserve, the density of filamentous algae increased.[1]

References[edit]

  1. ^ Uthicke, Sven; Schaffelke, Britta; Byrne, Maria (2009). "A boom–bust phylum? Ecological and evolutionary consequences of density variations in echinoderms". Ecological monographs 79: 324. doi:10.1890/07-2136.1. 

See also[edit]

  • Echinoids Excellent photo of the test the same site.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!