Overview
Distribution
Adriatic Sea, Aegean Sea, Atlantic Europe, Azores, Azores Exclusive Economic Zone, Central Mediterranean, European waters (ERMS scope), Greek Exclusive Economic Zone, Italy, Levantine Basin, Mediterranean Sea, Morocco, North Africa, Portuguese Exclusive Economic Zone, Western Mediterranean
-
Hayward, P.J.; Ryland, J.S. (Ed.) (1990). The marine fauna of the British Isles and North-West Europe: 1. Introduction and protozoans to arthropods. Clarendon Press: Oxford, UK. ISBN 0-19-857356-1. 627 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1
-
Hansson, H.G. (2001). Echinodermata, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 336-351
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1368
-
Hansson, H.G. (Comp.) 1998. NEAT (North East Atlantic Taxa): Scandinavian Echinodermata Check-List
http://www.marinespecies.org/echinoidea/aphia.php?p=sourcedetails&id=631
-
Natural Geography in Shore Areas (NaGISA) database, compiled by Ann Knowlton.
http://www.marinespecies.org/arms/aphia.php?p=sourcedetails&id=145467
-
Borges, P.A.V., Costa, A., Cunha, R., Gabriel, R., Gonçalves, V., Martins, A.F., Melo, I., Parente, M., Raposeiro, P., Rodrigues, P., Santos, R.S., Silva, L., Vieira, P. & Vieira, V. (Eds.) (2010). A list of the terrestrial and marine biota from the Azores. Princípia, Oeiras, 432 pp.
http://www.marinespecies.org/ascidiacea/aphia.php?p=sourcedetails&id=149079
-
Koukouras, Athanasios. (2010). Check-list of marine species from Greece. Aristotle University of Thessaloniki. Assembled in the framework of the EU FP7 PESI project.
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=142068
-
Koukouras, A., Sinis, A. I., Bobori, D., Kazantzidis, S. & Kitsos, M.-S. 2007. The echinoderm (Deuterostomia) fauna of the Aegean Sea, and comparison with those of the neighbouring seas. Journal of Biological Research 7, 67-92.
http://www.marinespecies.org/echinoidea/aphia.php?p=sourcedetails&id=149707
© WoRMS for SMEBD
Source:
World Register of Marine Species
Trusted
Ecology
Habitat
Known from rocky shores.
-
Natural Geography in Shore Areas (NaGISA) database, compiled by Ann Knowlton.
http://www.marinespecies.org/arms/aphia.php?p=sourcedetails&id=145467
© WoRMS for SMEBD
Source:
World Register of Marine Species
Trusted
Depth range based on 75 specimens in 1 taxon.
Water temperature and chemistry ranges based on 38 samples.
Environmental ranges
Depth range (m): 5.5 - 37
Temperature range (°C): 16.269 - 16.269
Nitrate (umol/L): 1.692 - 1.692
Salinity (PPS): 37.969 - 37.969
Oxygen (ml/l): 5.382 - 5.382
Phosphate (umol/l): 0.229 - 0.229
Silicate (umol/l): 1.778 - 1.778
Graphical representation
Depth range (m): 5.5 - 37
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 38 samples.
Environmental ranges
Depth range (m): 5.5 - 37
Temperature range (°C): 16.269 - 16.269
Nitrate (umol/L): 1.692 - 1.692
Salinity (PPS): 37.969 - 37.969
Oxygen (ml/l): 5.382 - 5.382
Phosphate (umol/l): 0.229 - 0.229
Silicate (umol/l): 1.778 - 1.778
Graphical representation
Depth range (m): 5.5 - 37
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Arbacia lixula
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
ATGCAACTAAGACGATGATTATTTTCTACAAACCATAAGGATATTGGAACTCTTTATCTTATCTTTGGAGCTTGAGCAGGCATGGTAGGAACAGCCATGAGAGTTATTATTCGAGCTGAACTTGCTCAACCCGGTTCTCTGCTTCAAGATGACCAAATTTACAATGTAGTAGTTACTGCACTTGCCCTCGTAATGATTTTTTTCATGGTAATGCCAATTATGATCGGGGGATTTGGTAACTGATTAATCCCCCTAATGATTGGTGCCCCCGATATGGCTTTCCCTCGAATGAACAATATGAGCTTTTGATTAATTCCTCCTTCTTTTATCCTACTATTAGCTTCTGCCGGGGTAGAAAGAGGAGCAGGAACAGGGTGAACCATTTATCCTCCCCTATCAAGTAAAATAGCACATGCGGGTGGATCTGTAGATCTTGCTATTTTTTCTCTACACTTGGCCGCTGCCTCTTCCATCTTAGCCTCAATAAATTTTATAACTACTATTATAAATATGCGAACGCCAGGGGTCTCTTTTGACCGTTTACCCCTTTTTGTGTGATCCGTATTCATAACAGCTTTTCTTTTGTTATTATCTCTACCAGTTCTAGCAGGGGCTATAACTATGTTATTAACAGACCGAAATATTAAAACCACCTTTTTTGACCCAGCAGGTGGAGGAGACCCTATTTATTTCCAACATCTATTTTGATTCTTTGGACACCCTGAAGTATATATTTTAATCCTTCCTGGCTTTGGAATGATTTCCCACGTAATAGCTCATTATGCTGGGAAGAGAGAACCATTTGGATATCTAGGAATGGTGTATGCTATGATTGCAATTGGAGTACTAGGATTCCTAGTTTGAGCCCACCACATGTTTACTGTCGGAATGGACGTAGATACCCGAGCCTATTTTACAGCAGCGACTATGATTATAGCTGTCCCTACCGGGATTAAGGTATTTAGCTGAATGGCAACCCTCCAAGGGTCTAATTTACAGTGGAGACCCCCTCTTTTATGAGCACTTGGATTTGTTTTTCTCTTTACACTAGGGGGATTAACAGGTATTCTATTAGCTAACTCCTCTATAGACGTGGTACTACACGATACCTACTATGTAGTTGCCCACTTTCACTATGTTCTTTCAATGGGAGCAGTCTTCGCTATTTTTGCTGGCTTTACTCACTGATTTCCACTATTCTCCGGATACAGCTTCCACCCACTTTGAAGTAAGGTACAGTTTTATATGTCATTGGAGTTAATCTTAACCTTTTTCCCCCAACACTTTTTAGGCCTCGCAGGAATGCCTCGTCGATACTCTGACTACCCAGATGCCTACACCTTATGAAATACAATTTCATCTATTGGCTCTACTATTTCGCTCGTTGAATTCCTGTTCTTTCTCTTTTTAATCTGAGAACCTTTCGCCTCAAAACGAGAAGGAATTTCTCCAGAATTCTCTCACGCATCACTAGAGTGGCAATATGCCTCTTTTCCCCCTTCCCACCATACCTTTGATGAAACACCTTCAACCGTTATTTTTATAAAGTAA
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Arbacia lixula
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 12
Species With Barcodes: 1
Public Records: 2
Specimens with Barcodes: 12
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Wikipedia
Arbacia lixula
The Black Sea Urchin, Arbacia lixula is a Sea Urchin found on the coast of the Mediterranean Sea and Macaronesian Islands (Azores, Madeira, Canary Islands), and less commonly, on the Atlantic coast of Western Africa and the Brazilian coast. It is found typically at shallow waters, at depths from 0 to 30 m, in rocky shores. It has a good resistance to hydrodynamism due to a good attachment strength to rocks.
See also
- Echinoids Excellent photo of the test the same site.
 | This echinoderm-related article is a stub. You can help Wikipedia by expanding it. |
Source:
Wikipedia
Unreviewed
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
