Overview

Comprehensive Description

Biology/Natural History: Like all our local urchins, this species eats algae. The teeth grow fast enough in the laboratory to be completely replaced in about 75 days. The species frequently holds rocks, shells, algae, or other debris over itself by its tube feet (picture), or is found in holes eroded into the bedrock, which they apparently dig with their spines and teeth (pictures). In areas where the giant brown kelp Macrocystis grows, that species is the preferred food. They sometimes eat chitons such as Katharina tunicata. In great numbers the urchin can have serious effects on the survival and regrowth of kelp beds after a storm destroys the full-grown kelp. Predators include otters, the seastar Pycnopodia helianthoides (which may swallow them whole), and occasionally the seastars Pisaster ochraceous and Dermasterias imbricata; some crabs, the anemone Anthopleura xanthogrammica, and sheephead fish. The urchin defends itself against seastars by lowering its spines, retracting its tube feet, raising its pedicellariae, and moving to another spot. Sea otter bones are stained purple from the pigment in this urchin's spines. The species tolerates a wide range of temperatures and salinities, from 5 to 23.5C and 80-110% seawater in the lab. Mass mortality occurs if temperatures exceed 26 C. The species requires well-oxygenated water, and obtains oxygen mainly through the tube feet, which are usually extended at least partway when under water. Symbionts include ciliated protozoans and the flatworm Syndisyrinx franciscanus in the gut, and externally the purple polychaete Flabelligera commensalis and the isopod Colidotea rostrata which live among the spines. Most spawning occurs in Jan-March (October-November off northern Baja California), though some reproductive individuals can be found in other seasons. Sexes are usually separate, though some hermaphrodites are found. They are easily induced to shed gametes, which are extensively used to study fertilization and early embryonic development. Urchin eggs fertilized with sand dollar sperm begin development but die as embryos. Off San Diego the gonadal index indicates reproductive activity in spring to summer, with much decreased gonadal index in late fall and early winter. The species grows slowly, with large size reached in about 10 years.

Recent scientific developments (See Scientific Articles section): This species' DNA sequence was reported in 2006 (Sea urchin gene sequencing consortium, 2006). It appears to have about 23,500 genes, similar to the number humans have. Although the larva (pluteus) of this species, which forms by about 2 days after fertilization, has only about 1500 cells of about 12 types, it takes a great deal of gene transcription to get it to that stage. About 11,500 protein-encoding genes and another 51,000 RNA's with some other function had been transcribed by that time. During this time period about 80% of the species' 283 transcription factor genes had already been used at least once. Others were used during development of the egg inside the mother. Together, the use of such a large proportion of the transcription factors so early in development implies that such regulatory genes may be used repeatedly and for different purposes at different stages of life. Other genes heavily involved during development include genes coding for general cytoskeletal and metabolic proteins, while fewer of the genes coding for immunity or sensory functions were transcribed during this period (Samanta et al. 2006).

Even though the urchin has no known organs specialized for light or chemoreception and does not even have a centralized brain, the species has 979 genes associated with sensing light or odors. This includes 6 genes for opsins, which are receptors for sensing light. In the adult at least some of these opsins seem to be concentrated in the pedicellariae and on the tips of the tube feet, while the pluteus has light-sensitive spots on the arms.

The urchin has a remarkably well-developed immune system (Rast et al. 2006). In its innate immune system, which is shared by both vertebrates and invertebrates, it has 218, or more than 10 times as many SRCR genes as do vertebrates and has 222 toll-like receptors compared with 10 for humans. It also has genes which have been associated exclusively with the vertebrate adaptive immune system, such as Rag genes which are involved in producing antibodies in vertebrates (the urchin does not produce antibodies). It also has genes associated with interleukins and tumor necrosis factors, which normally act as signals for vertebrate immune cells which the urchin lacks.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This urchin is a strong purple color (juveniles may be largely pale green but will likely have some purple). It may be found intertidally or subtidally, but mainly on the open coast. Diameter of test not over 10 cm (usually 5 cm or smaller) and spines rarely over 2.5 cm long. Ambulacral pore pairs arranged in curving arcs of eight on upper side of test.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Purple sea urchins are found on the pacific coastline from Alaska to Cedros Island, Mexico. (Olhausen and Russo, 1981)

Biogeographic Regions: pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographical Range: Cook Inlet, Alaska to Isla Cedros, Baja California. More abundant in the southern part of its range.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Strongylocentrotus purpuratus has a round body that consists of a radially symmetrical test, or shell, covered with large spines. The test itself ranges from 50mm in diameter to an occasional 100mm in diameter. This test is covered with spines that are generally bright purple for adults. Younger urchins have purple tinged spines that are mostly pale green in color. Also covering the test or shell, are tube feet and pedicellariae. The oral side of the urchin, on which the mouth is located, is usually the side facing the substrate (down). The aboral side of the urchin is usually the side of the urchin facing the observer (up). The body of S. purpuratus is radially semetrical. Male and female urchins are monomorphic; they are not physically distinguishable from one another. (Abbott et al., 1980; Olhausen and Russo, 1981; Ebert and Russell, 1988)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Syntype for Echinus purpuratus Stimpson, 1857
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Locality: Near San Francisco, California, United States, North Pacific Ocean
  • Syntype: Stimpson. 1857. Boston J. Nat. Hist. 6: 526.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

How to Distinguish from Similar Species: Small S. franciscanus can sometimes be purplish, but usually with a tinge of red, and grows much larger than this species.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

Strongylocentrotus purpuratus is primarily found in the low intertidal zone. The purple sea urchin thrives amid strong wave action and areas with churning aerated water. The giant kelp forests provide a feast for S. purpuratus. Many sea urchins can be found on the ocean floor near the holdfast of the kelp. (Calvin et al., 1985; Olhausen and Russo, 1981)

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 47 specimens in 1 taxon.
Water temperature and chemistry ranges based on 33 samples.

Environmental ranges
  Depth range (m): -1 - 205
  Temperature range (°C): 6.452 - 15.389
  Nitrate (umol/L): 0.988 - 30.351
  Salinity (PPS): 31.692 - 33.811
  Oxygen (ml/l): 2.565 - 6.656
  Phosphate (umol/l): 0.423 - 2.595
  Silicate (umol/l): 2.889 - 46.900

Graphical representation

Depth range (m): -1 - 205

Temperature range (°C): 6.452 - 15.389

Nitrate (umol/L): 0.988 - 30.351

Salinity (PPS): 31.692 - 33.811

Oxygen (ml/l): 2.565 - 6.656

Phosphate (umol/l): 0.423 - 2.595

Silicate (umol/l): 2.889 - 46.900
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth Range: Lower intertidal to 160 m depth

Habitat: _Lower intertidal and subtidal, on pilings. Usually in areas of at least moderate wave action (rarely found in Puget Sound or the inner Straits of Juan de Fuca).

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

As a sedentary invertebrate, S. purpuratus primarily feeds on algae. Bits of algae are a common food that urchins snag out of the water. The tube feet, spines, and pedicellariae that cover S. purpuratus are used to grab the food and aid it into the mouth. In addition to grabbing food out of the water, S. purpuratus scrapes algae off the rocks or substrate. It's mouth consists of a strong jaw piece called Aristotle's lantern. The mouthpiece itself has five bony teeth that are instrumental in scraping the algae off the substrate. While any algae will satisfy the appetite of the purple sea urchin, this species prefers the giant kelp Macrocystis pyrifera. (Calvin et al., 1985)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Strongylocentrotus purpuratus preys on:
detritus
Macrocystis pyrifera
Pterygophora californica

Based on studies in:
USA: California, Southern California (Marine)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Strongylocentrotus purpuratus is prey of:
Tealia coriacea
Kelletia kelletii
Astrometis sertulifera
Pimelometopon pulchrum
Dermasterias imbricata

Based on studies in:
USA: California, Southern California (Marine)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
20 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 50 years Observations: Even though the purple sea urchin has been an important model for biomedical research, its ageing process has not been studied in detail. Based on growth rates, it has been estimated that these animals can live over 50 years (Ebert 1967). Since evidence suggests that the red sea urchin (*Strongylocentrotus franciscanus*) is extremely long-lived with no detectable signs of ageing, the purple sea urchin may also be extremely long-lived and its maximum longevity may be considerably underestimated.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

January, February, and March are the primary reproductive months of S. purpuratus. It has been noted, however, that ripe individuals can be found even into the month of July. Purple sea urchins reach sexual maturity at the age of two years. At this time they are about 25mm in diameter or greater. Once sexually mature, females and males release their gametes into the ocean where fertilization occurs. The fertilized egg then settles and begins to grow into an adult. After the egg is fertilized and settles onto a substrate, the urchin begins to develop. The test develops quickly to protect the young urchin. The plates of the test begin to form individually and grow tighter together to form the test. As with most echinoderms, the sexes are usually separate. There is however an occasional hermaphrodite. (Abbott et al., 1980; Calvin et al., 1985; Mead and Denny, 1995)

Breeding interval: Sea urchins breed yearly.

Breeding season: January, February, and March are the primary reproductive months of S. purpuratus.

Average age at sexual or reproductive maturity (female): 2 years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); oviparous

Average age at sexual or reproductive maturity (male)

Sex: male:
730 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
730 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Crystals co-orient: purple sea urchin
 

The calcite crystals in purple sea urchin teeth are co-oriented thanks to propagation of existing crystallinity through an amorphous precursor.

   
  "Sea urchin teeth are remarkable and complex calcite structures,  continuously growing at the forming end and self-sharpening at the  mature grinding tip. The calcite (CaCO3) crystals of tooth  components, plates, fibers, and a high-Mg polycrystalline matrix, have  highly co-oriented crystallographic axes. This ability to co-orient  calcite in a mineralized structure is shared by all echinoderms.  However, the physico-chemical mechanism by which calcite crystals become  co-oriented in echinoderms remains enigmatic. Here, we show differences  in calcite c-axis orientations in the tooth of the purple sea  urchin (Strongylocentrotus purpuratus), using high-resolution  X-ray photoelectron emission spectromicroscopy (X-PEEM) and microbeam  X-ray diffraction (μXRD). All plates share one crystal orientation,  propagated through pillar bridges, while fibers and polycrystalline  matrix share another orientation. Furthermore, in the forming end of the  tooth, we observe that CaCO3 is present as amorphous calcium  carbonate (ACC). We demonstrate that co-orientation of the  nanoparticles in the polycrystalline matrix occurs via solid-state  secondary nucleation, propagating out from the previously formed fibers  and plates, into the amorphous precursor nanoparticles. Because  amorphous precursors were observed in diverse biominerals, solid-state  secondary nucleation is likely to be a general mechanism for the  co-orientation of biomineral components in organisms from different  phyla." (Killian et al. 2009:18404)
  Learn more about this functional adaptation.
  • Killian CE; Metzler RA; Gong YUT; Olson IC; Aizenberg J; Politi Y; Wilt FH; Scholl A; Young A; Doran A; Kunz M; Tamura N; Coppersmith SN; Gilbert PUPA. 2009. Mechanism of calcite co-orientation in the sea urchin tooth. J. Am. Chem. Soc. 131(51): 18404–18409.
  • 2008. Sea urchin yields key secret of biomineralization. ScienceDaily.
  • Politi Y; Metzler RA; Abrecht M, Gilbert B; Wilt FH; Sagi I; Addadi L; Weiner S; Gilbert PU. 2008. Transformation mechanism of amorphous calcium carbonate into calcite in the sea urchin larval spicule. PNAS. 105(45): 17362-6.
  • Tenenbaum D. 2009. Dental delight! Tooth of sea urchin shows formation of biominerals. University of Wisconsin News [Internet],
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Vision without eyes: purple sea urchin
 

The body of purple sea urchins may allow spatial vision due to diffuse photoreceptors on the body surface and spines that shield wide-angle light.

       
  "Sea urchins don't seem to have any problems avoiding predators or  finding comfortable dark corners to hide in, but they appear to  do all this without eyes. So how do they see? It appears that  sea urchins may use the whole surface of their bodies as a  compound eye, and the animals' spines may shield their bodies from  light coming from wide angles to enable them to pick out relatively  fine visual detail." (Knight 2010:i-a)



  Learn more about this functional adaptation.
  • Blevins E; Johnsen S. 2004. Spatial vision in the echinoid genus Echinometra. Journal of Experimental Biology. 207: 4249-4253.
  • Yerramilli D; Johnsen S. 2010. Spatial vision in the purple sea urchin Strongylocentrotus purpuratus (Echinoidea). Journal of Experimental Biology. 213: 249-255.
  • Knight K. 2010. Sea urchins use whole body as eye. Journal of Experimental Biology ,
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Genomic DNA is available from 9 specimens with morphological vouchers housed at Florida Museum of Natural History and Museum of Tropical Queensland and Queensland Museum
Public Domain

Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Strongylocentrotus purpuratus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBEH1469-06|NC_001453|Strongylocentrotus purpuratus| AGACGATGATTATTTTCTACTAACCACAAGGACATCGGAACACTTTATTTAATTTTTGGGGCCTGAGCTGGCATGGTAGGCACAGCTATG---AGTGTGATTATCCGTGCCGAGTTGGCACAACCTGGTTCGCTGCTAAAAGAT---GACCAGATATACAAAGTGGTCGTTACCGCACATGCGCTAGTCATGATTTTCTTCATGGTAATGCCAATAATGATTGGTGGATTTGGGAATTGACTCATTCCACTAATG---ATCGGTGCGCCAGATATGGCCTTCCCCCGCATGAAAAATATGAGTTTTTGACTTATTCCCCCTTCTTTTATATTACTTTTAGCGTCCGCAGGAGTAGAAAAAGGAGCAGGAACTGGCTGAACTATCTACCCTCCTCTCTCTAGTAAAATAACACACGCCGGTAGGTCCGTTGATTTA---GCAATCTTCTCCCTTCACCTGGCCGGTGCCTCTTCCATCTTGGGCCTCATTAAATTTATAACAACAATTATTAATATGCGGACACCGGGGATGTCTTTGGATCGTCTTCCTTTATTCGTCTGATCCGTCTTTGTCACTGCCTTCTTGCTCCTCCTTTCTCTTCCAGTATTAGCAGGA---GCAATTACAATGCTTCTCACAGATCGTAAAATAAACACAACTTTCTTTGACCCTGCAGGAGGGGGAGATCCAATTCTATTTCAACACCTATTCTGGCTTTTTGGACACCCCGAGGTGTATATTCTTATCTTACCGGGATTTGGTATGATCTCACACGTTATAGCTCACTACTCTGGTAAGCGA---GAGCCTTTCGGATACCTGGGGTTGGTTTATGCCATGATTGCAATAGGAGTTTTAGGATTCCTTGTCTGGGCCCACCATATGTTTACAGTAGGGATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Strongylocentrotus purpuratus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Species: 7
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Conservation Status

There is no special status listed for Strongylocentrotus purpuratus. However, the harvest of sea urchins poses some concern for the wellfare of the sea urchin population. As mentioned previously, sea urchins are being exported to Japan and other countries in astounding numbers. This leads some to believe that the populations of sea urchins are drastically declining. The California Department of Fish and Game is trying to control the harvesting of the sea urchin now, to insure that urchin populations do not become endangered. For now, they are simply limiting the number of permits available to fisheries. They are discussing other conservation techniques as well, that have not yet been implimented. (Sea Urchin Harvesters Association, 2000)

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

A negative effect directly on humans is not evident with S. purpuratus. It does, however, have an adverse effect in an indirect way. Purple sea urchins feed on the giant kelp, as mentioned previously. In their feeding, they can destroy entire forests of kelp. These kelp forests are commercially important for fisheries. They are even more important in that the blades of the kelp can be harvested for algin. Algin is a product that is used in the manufacturing of plastics and paints. It is also used as a thickening agent in foods such as gravy and pudding. Another use for algin is in making fibers that are instrumental in the manufacturing of fire resistant clothes. Without the kelp, algin could not be harvested. Strongylocentrotus purpuratus aides in the demise of the kelp forests that provide us with so many different products. (Readdie, 1998)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Strongylocentrotus purpuratus is actually used in many seafood recipes. Sea urchin is common in sushi. It is also considered a delicacy in some countries, especially Japan. The primary urchin harvesting company in California sends 75% of the harvest to Japan.The market value for urchins in Japan ranges from $2.20 per tray to $43.00 per tray. In 1994, Japan imported 6, 130 metric tons of sea urchins at a total value of 251 million dollars. Sea urchin harvesting has become one of the highest valued fisheries in California, bringing 80 million dollars in export value per year. (Calvin et al., 1985; Sea Urchin Harvesters Association, 2000)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Strongylocentrotus purpuratus

The purple sea urchin, Strongylocentrotus purpuratus, lives along the eastern edge of the Pacific Ocean extending from Ensenada, Mexico to British Columbia, Canada.[1] This sea urchin species is deep purple in color and lives in lower intertidal and nearshore subtidal communities. Along with sea otters and abalones, it is a prominent member of the spectacular kelp forest community.[2] It normally grows to a diameter of about 4 inches and it may live as long as 70 years.[3]

The purple sea urchin plays many roles.[4] Besides its ecological importance, it is also an important fishery along the west coast of the US[5] and it is one of several biomedical research models in cell and developmental biology.[6]

Because of its importance to biomedical research, the sea urchin genome was completely sequenced and annotated in 2006.[7] The sea urchin genome is estimated to encode about 23,300 genes. Many of these genes were previously thought to be vertebrate innovations or were only known from groups outside the deuterostomes. Thus the sea urchin genome provides a comparison to our own and those of other deuterostomes, the larger group to which both echinoderms and humans belong.[7] Using the strictest measure, the purple sea urchin and humans share 7,700 genes.[8] Many of these genes are involved in sensing the environment,[9] a fact surprising for an animal lacking a head structure.

References

  1. ^ Ricketts EF, Calvin J. Between Pacific Tides. 3rd Rev. edn. 1962 by J.W. Hedgpeth. XII 516. Stanford University Press, Stanford, CA. 1939
  2. ^ Pearse, J. S. 2006. The ecological role of purple sea urchins. Science 314: 940-941.
  3. ^ T.A. Ebert, J. R. Southon, 2003. Fish. Bull. 101, 915
  4. ^ L. Rogers-Bennett, in ```Edible Sea Urchins: Biology and Ecology```, J.M. Lawrence, Ed. (Elsevier, Amsterdam, Netherlands, 2007), pp. 393-425
  5. ^ D. Sweetnam et al., Calif. Coop. Oceanic Fish. Invest. Rep. 46: 10 (2005).
  6. ^ SU White Paper
  7. ^ a b Sea Urchin Genome Sequencing Consortium. 2006. The genome of the sea urchin, Strongylocentrotus purpuratus. Science 314: 941-952
  8. ^ Materna, S.C., K. Berney, and R.A. Cameron. 2006a. The S. purpuratus genome: A comparative perspective. Dev. Biol. 300: 485-495.
  9. ^ Burke, R.D., L.M. Angerer, M.R. Elphick, G.W. Humphrey, S. Yaguchi, T. Kiyama, S. Liang, X. Mu, C. Agca, W.H. Klein, B.P. Brandhorst, M. Rowe, K. Wilson, A.M. Churcher, J.S. Taylor, N. Chen, G. Murray, D. Wang, D. Mellott, R. Olinski, F. Hallböök, M.C. Thorndyke. 2006. A genomic view of the sea urchin nervous system. Dev. Biol. 300: 434-460.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!