Overview

Brief Summary

Fossil species

Fossil range: recent & fossil
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology/Natural History: Adult sand dollars move mainly by waving their spines, while juveniles use their tube feet. The tube feet along the petalidium are larger and are used for respiration. Tube feet elsewhere on the body are smaller and are used for feeding and locomotion. Individuals live subtidally, just beyond the surf, and flat on the bottom or at an angle and partly buried. They frequently move around if they are lying flat. If a current is present they usually lie at an angle and partly buried. Most individuals in the colony will be lying at a similar angle. In very rough water most lie flat and partly buried. Adults feed on detritus and diatoms swept to the mouth by cilia. If lying at an angle, it also catches small prey and algae with its pedicellariae, tube feet, and spines and passes them to the mouth. Their mouth includes a small aristotle's lantern. Predators include the seastar Pisaster brevispinus and the starry flounder Platichthys stellatus. Sometimes settled on by a small barnacle Balanus pacificus. Spawn in late spring and early summer. Fertilization is external. Juveniles swallow heavy sand grains, especially those with iron, which may help serve as a "weight belt" for them. May live 10-13 years. May be aged by counting growth rings on the plates of the test. Relative ages of individuals can be determined by counting the pores in a petal of the petalidium.

Vaughn and Strathmann (2008) discovered that when pluteus larvae of this species are exposed to mucus from a fish predator, they begin to divide asexually by budding and fission. This results in a smaller average size for the larvae and also in a longer time for development. Vaughn and Strathman hypothesized that the adaptive value of this response may be that the smaller individuals are less likely to be eaten by the fish--a refuge in size. Presumably the slower development and longer time they spend as a pelagic larva, which is usually regarded as a disadvantage, is counterbalanced in this case by the temporary avoidance of fish predation.

Steven C. Beadle (1991) notes that dendrasterid sand dollars such as this species are first found in late Miocene sediments in central California. They spread north to Alaska during the Quaternary and supplanted an abundant older fauna of symmetrical sand dollars.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

A highly flattened, irregular echinoid (sand dollar) with very short, dark spines when alive that make it appear almost velvety (see photo above). Dead individuals have a gray test and a clearly visible, off-centered petalidium on the aboral side (photo). The excentricus in the name refers to the off-center petalidium. Diameter to 8 cm.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

"A flat, round type of urchin up to 10 cm in diameter with tiny spines like fuzz, covering the surface... Blackism-purple, dark brown or grey. The posterior half is usually darker than the anterior which is usually buried in the sand. Dead animals that have lost their spines are white." (Lambert, Austin 2007)

Public Domain

Browne, Joy

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Canadian Exclusive Economic Zone [Pacific part], FAO fishing area 67, North East Pacific, North Pacific
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographical Range: Alaska to Baja California.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

"Juneau, Alaska, to northern Baja California; 0-90 metres." (Lambert, Austin 2007)

Public Domain

Browne, Joy

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

"The mouth is central and the anus is near the posterior edge on the oral side. The petal-like pattern on the dorsal surface corresponds to the five ambulacra of regular urchins. In this species it is offset from the centre toward the posterior. The anterior petal is longer than the others. The food grooves are concentrated on the posterior half of the test; they branch out from the mouth distally and have smaller side branches" (Lambert, Austin 2007)

Public Domain

Browne, Joy

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

How to Distinguish from Similar Species: This is the only species of sand dollar found in Washington and Oregon. As with other sand dollars this species is very flat, at least 5x as wide as tall. All other echinoids in the area are at least half as tall as wide. Several other sand dollars can be found on the Pacific coast. D. vizcainoensis lives in Baja California and has coarser tubercles. D. laevis is smaller and fragile, with a smaller petalidium and lives in deeper water off California. The northern sand dollar, Echinarachnius parma, is flatter, more symmetrical, and the petalidium is more centered on the shell. It lives in Alaska and the Arctic Ocean.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

"The only other sand dollar in this region is Echinarachnius parma, which has the petal-like pattern in the centre of the test rather than toward the posterior edge." (Lambert, Austin 2007)

Public Domain

Browne, Joy

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 120 specimens in 1 taxon.
Water temperature and chemistry ranges based on 41 samples.

Environmental ranges
  Depth range (m): 0 - 157
  Temperature range (°C): 6.640 - 12.053
  Nitrate (umol/L): 3.146 - 22.690
  Salinity (PPS): 31.460 - 33.143
  Oxygen (ml/l): 3.837 - 6.649
  Phosphate (umol/l): 0.643 - 2.182
  Silicate (umol/l): 8.443 - 51.234

Graphical representation

Depth range (m): 0 - 157

Temperature range (°C): 6.640 - 12.053

Nitrate (umol/L): 3.146 - 22.690

Salinity (PPS): 31.460 - 33.143

Oxygen (ml/l): 3.837 - 6.649

Phosphate (umol/l): 0.643 - 2.182

Silicate (umol/l): 8.443 - 51.234
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth Range: Just below the surf zone on sandy bottoms, down to 40 m depth (but mostly more shallow)

Habitat: Subtidal on sandy bottoms, on open coast and in sandy lagoons. A few live intertidally and bury themselves.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

"Usually found along sheltered shores on sandy beaches near the low tide mark." (Lambert, Austin 2007)

Public Domain

Browne, Joy

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

"Dendraster excentricus is primarily a suspension feeder, rather than a deposit feeder like most other species of sand dollars. With the body vertical in the sand, they can capture larger suspended particles and some active prey. Barrel-tipped tupe feet extend outside the spines to capture dinoflagellates, small crustaceans, diatoms and pieces of algae. Tube feet beside and in the food grooves move the particles toward the mouth with the aid of mucus; cilia are not involved in moving the food. Near the mouth, oral tube feet and oral spines push the food into the mouth where it is collected and macerated by the jaws." (Lambert, Austin 2007)

Public Domain

Browne, Joy

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Associations

"Few predators are known, except for the Glaucous-winged Gull (Larus glaucescens), which can break the tests (shell) of exposed individuals and eat the soft parts...The flatworm Syndesmis dendrastrorum occurs in the intestine anywhere from the esophagus to the rectum." (Lambert, Austin 2007)

Public Domain

Browne, Joy

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

"Few live longer than nine years." (Lambert, Austin 2007)

Public Domain

Browne, Joy

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

"In the San Juan Islands, spawning usually occurs from mid April to July, but potentially from late March to late summer." (Lambert, Austin 2007)

Public Domain

Browne, Joy

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Growth

"The growth rate is fairly steady until about the fifth year, when it slows greatly." (Lambert, Austin 2007)

Public Domain

Browne, Joy

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dendraster excentricus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACACTATATTTAATTTTTGGAGCCTGAGCAGGAATGGTTGGAACTGCTATGAGCGTAATCATACGAGCAGAGCTCGCACAGCCTGGATCTTTACTCCAAGATGATCAAATTTATAATGTAATAGTAACTGCACACGCCTTAGTAATGATCTTTTTCATGGTAATGCCTATAATGATAGGAGGATTTGGAAACTGATTAATCCCCTTAATGATTGGGGCTCCAGATATGGCTTTCCCCCGAATGAATAAAATGAGATTCTGACTAATCCCTCCATCATTTATCTTACTTCTAGCATCAGCGGGAGTAGAAAGAGGAGCTGGAACAGGATGAACTATTTACCCCCCTCTCTCTAGAAACATAGCACACGCAGGAGGATCAGTAGACCTTGCTATTTTTTCTTTACACTTAGCCGGTGCCTCTTCAATTCTGGCATCTATAAACTTCATTACTACTATTATTAATATGCGAACCCCTGGAATCTCCTTTGACCGGCTTCCTTTATTTGTGTGATCAGTTTTTGTGACCGCTTTCCTTTTACTCCTGTCTCTCCCAGTTTTAGCAGGGGCAATTACAATGCTTTTAACAGACCGAAACATAAATACCACATTCTTTGACCCAGCAGGAGGAGGTGATCCTATTCTCTTTCAGCATCTTTTCTGGTTTTTTGGGCACCCAGAAGTCTATATCTTAATACTCCCAGGATTTGGAATGATCTCTCACGTAATTGCCCACTACTCCGGAAAGCGAGAACCATTTGGTTACCTAGGAATGGTTTACGCTATGATAGCAATAGGAATTCTAGGATTTTTAGTTTGGGCTCACCATATGTTTACTGTTGGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Dendraster excentricus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

The sand dollar Dendraster excentricus has been found to benefit humans in multiple ways. It is an effective indicator of marine sediment contamination levels, and the body composition of sand dollars in general, has displayed promise as a future template for bone substitutes in tissue regeneration studies.

Measurement of juvenile sand dollar growth is an effective way of differentiating between low to moderate levels of contamination in marine sediments. It has been found that their growth is significantly inhibited with even small amounts of contamination exposure. Marine sand dollar growth is an extremely important indicator because small amounts of contamination have previously been difficult to detect, and overall marine health depends on a quality upper sediment layer in the benthic zone (Cassilas et. al, 1992).

Another important contribution sand dollars offer to humans is their overall body structure. Recently there have been experiments conducted with the similar species Clypeaster subdepressus to determine if the sand dollar structure (common to all species, composed of magnesium calcite, and demonstrating interconnected porosity) could be used as temporary substitutes for bone in bone tissue engineering. Previously, corals had shown promise in therapies involving bone replacement, but their increased harvest had affected the ecological equilibrium of the habitats from which they were removed. Sand dollars are similar to corals in anatomical structure and can be harvested in moderation without adverse effects to the environment (Barreiro et al. 2010). This puts them in an excellent position to be used as in biomedical applications. Fragments of sand dollar exoskeletons (tests) are washed, coated with bacteria culture repeatedly, and then dried. When immersed in a solution of artificial body fluid, they have demonstrated accumulation of calcium phosphate on their skeleton. This accumulation of calcium phosphate throughout the porous sand dollar skeleton provides a surface that is biotolerant and can support cellulose synthesis. With this platform for bone tissue in place, cell growth and attachment can occur, and with this nutrient exchange from cells in the surrounding area, damaged bone tissue can be regenerated. This demonstrates that sand dollars can be used as effective templates in the advancing field of tissue engineering, primarily bone tissue (Barreiro et. al 2009).

With the increasing benefits sand dollars offer to humans, it is understandable that efforts to locate new populations will be expanded. The use of acoustic techniques, such as convergence of acoustic backscatter, has proven effective in locating large distributions of the sand dollar Dendraster excentricus. As ideal environments for sand dollar growth are identified, measures can be taken to promote and maintain ecological factors that encourage population growth (Fenstermacher et. al 2001).

Public Domain

Anoka Ramsey Community College

Source: Anoka Ramsey Community College

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Dendraster excentricus

Eccentric sand dollar (Dendraster excentricus), also known as the sea-cake, biscuit-urchin, western sand dollar, or Pacific sand dollar, is a member of the order Clypeasteroida, better known as sand dollars, a species of flattened, burrowing sea urchins found along the Pacific Ocean from Alaska to Baja California.

Contents

General information

Dendraster excentricus is an irregular echinoid that is flattened and burrows into the sand, unlike the regular echinoids,or sea urchins. It can be found living in the Pacific Ocean from Alaska to Baja California.The range for Dendraster excentricus is larger and includes the range of the other two extant species of Dendraster: D. vizcainoensis and D. terminalis. The flower pattern in this species is off-center, giving it the species name excentricus. Its test (skeleton) is compared to that of a sea urchin below.

Description

They are colored gray, brown, black or shades of purple. Their size is variable but up to 100 mm wide, and a dome shaped carapace varying in height to about 10 mm, with a circular body or test. Their body is covered with fine, spiny tube-like feet with cilia, and like other echinoderms they have five-fold radial symmetry. The mouth, anus, and food grooves are on the lower (oral) surface and the aboral surface has a petalidium, or petal shaped structure, with tube feet. Dead individuals have a gray/white test, or skeleton, which is often found washed up on beaches. It has a water-vascular system from the internal cavity or coelom that connect with tube feet. The tube feet are arranged in five paired rows and are found on the ambulacra—the five radial areas on the undersurface of the animal, and are used for locomotion, feeding, and respiration. Spines are generally club shaped in adults, and less so in juveniles. The five ambulacral rows alternate with five interambulacral areas, where calcareous plates extend into the test. At the center on the aboral side is the madreporite—a perforated platelike structure, and on the interambulacra are the four tiny genital pores. Radiating out from the genital pores are the five flower petals, which represents the ambulacral radii. The mouth is in the center on the bottom side, with the anus toward the edge.

Habitat

They are either found subtidally in bays or open coastal areas or in the low intertidal zone on sandy on the Northeast Pacific coast. It can live at a depth of 40 to 90 meters, but usually is found in more shallow areas. Sand dollars are usually crowded together over an area half buried in the sand. As many as 625 sand dollars can live in one square yard (0.85 sq m). It is the only sand dollar found in Oregon and Washington. It has been found on Burfoot Beach in the South Puget sound.

Behavior and feeding

Like its cousins, dendraster is a suspension feeder which feeds on crustacean larvae, small copepods, diatoms, plankton, and detritus. Adult sand dollars move mainly by waving their spines, while juveniles use their tube feet. The tube feet along the petalidium are larger and are used for respiration while tube feet elsewhere on the body are smaller and are used for feeding and locomotion. They frequently move around if they are lying flat. When feeding they usually lay at an angle with their anterior end buried and catch small prey and algae with its pedicellariae, tube feet, and spines and pass them to the mouth. Their mouth includes a small Aristotle's lantern structure found in most Echinoids. In high currents adults grow heavier skeletons while juveniles swallow heavy sand grains to keep from being swept away. They will bury themselves when they are being preyed on.

Hydrofoil design

This particular species of sand dollar is known for its curious behavior:

When exposed to a steady flow of water, they gather in groups, forming aligned rows in the sand, while digging their front edge in and raising their back edge into the flow of water, lined up so it passes from right to left across their bodies. Because the shape of a sand dollar is a hydrofoil, this draws particles of food closer in to their mouths during feeding, a benefit enhanced by the alignment of many individuals together into a communal feeding group.

Reproduction

Sexes are separate, with no noticeable differences in external features of the two sexes.Reproduction is sexual and D. excentricus reaches sexual maturity between 1 and 4 years of age, spawning in late spring and early summer. Fertilization is external,the female Dendraster discharges the eggs through her gonopores and they are fertilized by the male, who protrudes his genital papilla from his body wall.This is one reason they are believed to live in large groups and tend to release gametes at the same time into the water column. Eggs are pale orange, and are covered by a thick jelly coat which keeps adults from eating the eggs.

Development

The first larval stage is called a prism. After this stage the embryo will develop two arms transforming itself into an echinopluteus larva. This is followed by the development of arms, until it reaches 8 arms all together. After this the larva develops an echinus or juvenile rudiment, which will become the juvenile. The nektonic larvae are pelagic and travel away from the parent group with the current. The developed larvae will receive a chemical cue from adults to settle down into a bed of sand dollars and begin to undergo metamorphosis to their adult sand dollar form. As adults they are benthos and stay on the sandy bottom.

Lifespan and predation

Predators include the seastar Pisaster brevispinus and the starry flounder Platichthys stellatus as well as crabs and sea gulls. They are sometimes settled on by a small barnacle, Balanus pacificus. Large storms or high temperatures and desiccation can cause mass mortality if low tide coincides with a hot midday and the animals are exposed to air for just 2 to 3 hours or washed up and buried in the sand. Old age is thought to be the main cause of death of Dendraster excentricus. They may live up to 13 years and can be aged by counting growth rings on the plates of the test or by counting the pores in a petal of the petalidium.

Conservation

The habitat they live in on the sandy seafloor is sometimes damaged by bottom trawling, causing harm to many organisms. Ocean acidification and sea surface warming also harm populations of sand dollars.

References

  1. ^ Dave Cowles (2006). "Echinarachnius excentricus (Eschscholtz, 1831)". Walla Walla University. Retrieved January 29, 2010. 
  • Dendraster excentricus Intertidal Marine Invertebrates of the South Puget Sound
  • Dendraster excentricus Walla Walla
  • Biogeography of the Western Sand dollar San Francisco State University
  • Sand dollar, Monterey Bay Aquarium
  • The persistance of a sand dollar, OnEarth.org
  • Strathrnann M. 1987. Reproduction and Development of Marine Invertebrates of the Northern Pacific Coast. University of Washington Press, Seattle, Washington. 670 pp.
  • Morris R.H., Abbott D.P., Haderlie E.G. 1992. Intertidal Invertebrates of California. Stanford University Press, Stanford, California. 580 pp.
  • Marin Jarrin, Jose R. "Embriogenesis and Larval Stages of Dendraster excentricus". 2007. University of Oregon, Eugene, Oregon.
  • Smith, Andrew. 1984. Echinoid Palaeobiology. London: George Allen & Unwin.

Further reading

  • Rich Mooi. "Sand Dollars of the Genus Dendraster (Echinoidea:Clypeasteroida): Phylogenetic Systematics, Heterochrony, and Distribution of Extant Species". Bulletin of Marine Science, 61(2): 343–375, 1997.
  • Friedrich von Hellwald - The standard natural history, Volume 1, The Standard Natural History, Elliott Coues, Editors John Sterling Kingsley, Elliott Coues. Publisher S.E. Cassino and company, 1884, Pages 171–172.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!