Overview

Brief Summary

Ecology

Ecology: benthic, inshore, continental shelf, deposit feeder. General distribution: temperate, discontinuous (west Pacific Ocean, NZ, South Africa, Gulf of California, north Atlantic Ocean), depth range 0-230? m. (Rowe & Gates, 1995). Also distributed in Australia (Rowe & Gates, 1995).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Breeding occurs in summer. The pelagic larvae are sometimes found in enormous quantities and likewise the young can be found in large amounts on the sediment surface. The growth rate of E. cordatum varies with the environment. It grows faster in shallow, sandy than in deep, muddy areas, possibly under the influence of temperature. The species can live for 10 to 20 years (Mortensen, 1927; Wolff, 1973; Fish & Fish, 1989; Rees & Dare, 1993). 

 Depending on the temperature, the species digs a few centimetres to about 20 cm deep into the sediment. A respiratory channel (chimney) leads from the hole to the surface and one or two sanitary drains are located horizontally behind the echinoid. The animal is isolated from the sediment by a mucus veil, which plasters the burrow. E. cordatum plays an important role in sediment bioturbation (Mortensen, 1927; De Ridder et al., 1987; Fish & Fish, 1989; Rees & Dare, 1993). E. cordatum is a non-selective deposit feeder. lt collects particles from the s

  • Holtmann, S.E.; Groenewold, A.; Schrader, K.H.M.; Asjes, J.; Craeymeersch, J.A.; Duineveld, G.C.A.; van Bostelen, A.J.; van der Meer, J. (1996). Atlas of the zoobenthos of the Dutch continental shelf. Ministry of Transport, Public Works and Water Management: Rijswijk, The Netherlands. ISBN 90-369-4301-9. 243 pp.   http://www.marinespecies.org/aphia.php?p=sourcedetails&id=83 External link.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

 A heart shaped urchin covered in a dense felt of yellow spines, mostly directed backwards. Yellow-brown in colour and usually 6 cm in length although can grow up to 9 cm long.The common name of this species refers to the brittle, brownish test, which is often found washed up on sheltered sandy shores.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

A heart-shaped sea urchin which burrows in clean sand. The test is truly heart-shaped with a definite indentation in the broader end, corresponding with the sunken frontal ambulacrum. In Echinocardium species there is an inner fasciole surrounding the frontal ambulacrum and the apical plates. Up to 9cm in length. Similar to other Echinocardium species but distinguished by the depressed frontal ambulacrum.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Distribution

Adriatic Sea, Aegean Sea, Atlantic Coast of France, Azores, Azores Exclusive Economic Zone, Belgian Exclusive Economic Zone, Belt Sea, Bohuslän, British Isles, Calais, Central Mediterranean, De Haan, De Panne, Dutch Exclusive Economic Zone, English Channel, European waters (ERMS scope), French Exclusive Economic Zone [Atlantic part], French Exclusive Economic Zone [Mediterranean part], Greek Exclusive Economic Zone, Irish Exclusive economic Zone, Kattegat, Koksijde, Levantine Basin, Lombardsijde, Mediterranean Sea, Mozambique, New Zealand Exclusive Economic Zone, North Cape (Norway), North Coast of Norway, North East Atlantic, North Sea, Oostduinkerke, Oostende, Oosterschelde, Öresund, South Africa (country), United Kingdom, United Kingdom Exclusive Economic Zone, Wadden Sea, Western Mediterranean, Wimereux, Zeeland
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

This cosmopolitan echinoderrn was found in about half of all samples. The species is very abundant north of the Dutch Wadden islands and is also present in Delta and the western part of the Wadden Sea. The distribution of the biomass is very patchy.
  • Holtmann, S.E.; Groenewold, A.; Schrader, K.H.M.; Asjes, J.; Craeymeersch, J.A.; Duineveld, G.C.A.; van Bostelen, A.J.; van der Meer, J. (1996). Atlas of the zoobenthos of the Dutch continental shelf. Ministry of Transport, Public Works and Water Management: Rijswijk, The Netherlands. ISBN 90-369-4301-9. 243 pp.   http://www.marinespecies.org/aphia.php?p=sourcedetails&id=83 External link.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Cosmopolitan (World Oceans)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Lower shore and subtidal to 200 m depth, burrowing in sand or muddy sand, all round the British Isles. Apparently cosmopolitan in temperate seas
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

In the 1976-1986 period Echinocardium cordatum was mainly found near the Flemish Banks (maximum 50 ind./m2) whereas it was absent in the eastern coastal zone and near the Hinder Banks. In the 1994-2001 period the species is clearly distributed more widely: E. cordatum was only absent in the eastern coastal zone and reached densities up to 200 ind./m2. As the species lives burrowed in the sand (up to 20 cm deep) there is a real chance that the Van Veen grab fails to scoop up E. cordatum. Consequently, the species may have a broader distribution than mentioned here.
  • Degraer S., J. Wittoeck, W. Appeltans, K. Cooreman, T. Deprez, H. Hillewaert, K. Hostens, J. Mees, E. Vanden Berghe & M. Vincx (2006). The macrobenthos atlas of the Belgian part of the North Sea. Belgian Science Policy. D/2005/1191/3. ISBN 90-810081-6-1. 164 pp.   http://www.marinespecies.org/aphia.php?p=sourcedetails&id=9234 External link.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Very common all round the British Isles from low tide mark to moderate depths.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Diagnostic Description

Morphology

This sea urchin has a heart-shaped test, usually 40-50 mm in length. lt is covered with a large number of closely set spines, most of them directed backwards. In profile the highest point of the test lies towards the posterior. lt is yellow-brown in colour (Mortensen, 1927; Southward, 1972; Fish & Fish, 1989; Hayward & Ryland, 1990).
  • Holtmann, S.E.; Groenewold, A.; Schrader, K.H.M.; Asjes, J.; Craeymeersch, J.A.; Duineveld, G.C.A.; van Bostelen, A.J.; van der Meer, J. (1996). Atlas of the zoobenthos of the Dutch continental shelf. Ministry of Transport, Public Works and Water Management: Rijswijk, The Netherlands. ISBN 90-369-4301-9. 243 pp.   http://www.marinespecies.org/aphia.php?p=sourcedetails&id=83 External link.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The cordiform body of the sea potato is protected by a calcite skeleton and measures up to 60 mm. The skeleton is covered with soft spines that lie flat on the body and point towards the back. Yellowish brown in colour.
  • Degraer S., J. Wittoeck, W. Appeltans, K. Cooreman, T. Deprez, H. Hillewaert, K. Hostens, J. Mees, E. Vanden Berghe & M. Vincx (2006). The macrobenthos atlas of the Belgian part of the North Sea. Belgian Science Policy. D/2005/1191/3. ISBN 90-810081-6-1. 164 pp.   http://www.marinespecies.org/aphia.php?p=sourcedetails&id=9234 External link.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

The fact that E. cordatum is present in the entire area (North Sea) indicates that the echinoderm is not very selective with regard to the type of sediment, although a slight preference for sandy bottoms can be detected. Earlier investigations suggest that, indeed, sandy substrates may be favoured (Rees & Dare, 1993). In a study along a transect in the central and southern North Sea, Duineveld & Jenness (1984) found E. cordatum to account for 50% of the benthic biomass at sandy sites and 5% at muddy sites.
  • Holtmann, S.E.; Groenewold, A.; Schrader, K.H.M.; Asjes, J.; Craeymeersch, J.A.; Duineveld, G.C.A.; van Bostelen, A.J.; van der Meer, J. (1996). Atlas of the zoobenthos of the Dutch continental shelf. Ministry of Transport, Public Works and Water Management: Rijswijk, The Netherlands. ISBN 90-369-4301-9. 243 pp.   http://www.marinespecies.org/aphia.php?p=sourcedetails&id=83 External link.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Echinocardium cordatum occurs in sediments with a wide range of grain sizes (median grain size up to 650 µm), but clearly prefers sediments with a median grain size of 200 to 300 µm (relative occurrence ± 40%). The species is only found in sediments with a low mud content (< 20%).
  • Degraer S., J. Wittoeck, W. Appeltans, K. Cooreman, T. Deprez, H. Hillewaert, K. Hostens, J. Mees, E. Vanden Berghe & M. Vincx (2006). The macrobenthos atlas of the Belgian part of the North Sea. Belgian Science Policy. D/2005/1191/3. ISBN 90-810081-6-1. 164 pp.   http://www.marinespecies.org/aphia.php?p=sourcedetails&id=9234 External link.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 2340 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1250 samples.

Environmental ranges
  Depth range (m): 0 - 454
  Temperature range (°C): 6.506 - 24.665
  Nitrate (umol/L): 0.325 - 16.868
  Salinity (PPS): 31.635 - 36.231
  Oxygen (ml/l): 4.605 - 6.746
  Phosphate (umol/l): 0.093 - 0.890
  Silicate (umol/l): 0.756 - 11.419

Graphical representation

Depth range (m): 0 - 454

Temperature range (°C): 6.506 - 24.665

Nitrate (umol/L): 0.325 - 16.868

Salinity (PPS): 31.635 - 36.231

Oxygen (ml/l): 4.605 - 6.746

Phosphate (umol/l): 0.093 - 0.890

Silicate (umol/l): 0.756 - 11.419
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

 Echinocardium cordatum lives in a permanent burrow buried about 8 cm deep (to 15 cm) in sandy sediments. The species is found from the intertidal to the subtidal and offshore to about 200 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Lives buried in clean sand at a depth of 10-15cm. There is usually a conical depression at the surface corresponding with the position of the animal. Food in the form of detritus collects in this depression and is passed down to the buried animal by the long tube-feet of the frontal ambulacrum.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Breeding

Echinopluteus larva. Summer
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Echinocardium cordatum

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBEH3060-10|FN562581|Echinocardium cordatum| AGACGATGATTATTTTCTACTAACCACAAGGACATCGGAACACTTTATCTAGTATTTGGTGCCTGAGCAGGCATGGTCGGGACCGCCATG---AGAGTAATTATCCGGGCAGAGTTAGCTCAGCCTGGGTCCTTACTACAAGAT---GACCAAATATATAAAGTTATTGTAACAGCCCACGCTCTAGTAATGATATTTTTTATGGTAATGCCAATAATGATTGGGGGATTTGGAAACTGACTAATCCCACTAATG---ATTGGTGCCCCAGACATGGCATTCCCCCGAATGAACAAAATGAGCTTCTGATTAGTTCCCCCATCATTCATTTTACTCCTCGCCTCGGCAGGGGTAGAAAGCGGAGCAGGAACGGGATGAACAATTTATCCCCCCCTTTCCAGTAACATAGCCCATGCAGGGGGAAGAGTAGACCTT---GCCATCTTCTCCCTCCACCTTGCTGGGGCTTCTTCAATTCTAGCCTCTATAAATTTTATAACCACTATAATCAAAATGCGGGCCCCTGGAATTTCTTTCGACCGGCTCCCACTCTTCGTTTGGTCAGTTTTTGTGACAACATTTCTACTTTTATTGTCTCTTCCGGTACTTGCTGGG---GCAATTACGATGCTTCTAACGGATCGAAACATCAACACAACGTTCTTTGACCCCGCAGGAGGAGGAGACCCCATCCTGTTTCAACACCTGTTTTGGTTTTTTGGCCACCCAGAAGTTTATATTCTAATTTTGCCAGGGTTCGGGATGATTTCCCATGTTATAGCCCACTATTCTGGGAAGCGA---GAGCCATTTGGTTATCTGGGTATGGTATACGCAATGATAGCTATAGGAATCCTTGGGTTCTTAGTTTGGGCACACCACATGTTTACAGTCGGGATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Echinocardium cordatum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 7
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Echinocardium cordatum

Echinocardium cordatum, or the sea potato, is a sea urchin in the family Loveniidae. It is found in sub-tidal regions in temperate seas around the world and lives buried in the sandy sea floor.

Contents

Description

Test without spines

The sea potato is a heart shaped urchin clothed in a dense mat of furrowed yellowish spines which grow from tubercles and mostly point backwards. The upper surface is flattened and there is an indentation near the front. It is a fawn colour but the tests that are found on the strandline have often lost their spines and are white. The spines trap air which helps prevent asphyxiation for the buried urchin.[2] The ambulacrum forms a broad furrow in a star shape extending down the sides of test. There are two series each of two rows of tube feet. The test reaches from six to nine centimetres in length.[3]

Distribution

The sea potato has a discontinuous cosmopolitan distribution. It is found in temperate seas in the north Atlantic Ocean, the west Pacific Ocean, around Australia, New Zealand, South Africa and the Gulf of California at depths of down to 230 metres.[1] It is very common round the coasts of the British Isles in the neritic zone.[4]

Biology

The sea potato buries itself in sand to a depth of ten to fifteen centimetres. It occurs in sediments with a wide range of grain sizes but prefers sediments with a size of 200 to 300 µm and a low mud content.[5] It makes a respiratory channel leading to the surface and two sanitary channels behind itself, all lined by a mucus secretion.[1] The location of burrows can be recognised by a conical depression on the surface in which detritus collects. This organic debris is used by the buried animal as food and is passed down by means of the long tube feet found in the front of the ambulacrum.[4]

The sexes are separate in the sea potato and the males and females both liberate gametes into the water table in the spring. The echinoplutei larvae that develop after fertilisation have four pairs of arms and are laterally flattened. In late stage larvae, tube feet may be seen developing round the skeleton.[6] The larvae are pelagic and form part of the zooplankton. Metamorphosis take place about 39 days after fertilisation with the larvae settling out and burrowing into the substrate.[7] The lifespan of the sea potato is thought to be ten or more years.[8]

Ecology

In the sandy sea bed that it favours, the sea potato is often found in association with the bivalve molluscs Tellina fabula, Ensis ensis and Venus striatula.[9]

The bivalve Tellimya ferruginosa is often found living inside the sea potato's burrow as a commensal. Up to fourteen have been found in one burrow with the young being attached to the spines of the urchin by byssus threads.[10] Another species that makes use of the burrow is the amphipod crustacean, Urothoe marina.[11]

References

  1. ^ a b c d World Register of Marine Species
  2. ^ European Marine Life
  3. ^ Marine Life Information Network
  4. ^ a b National Museums of Northern Ireland
  5. ^ Degraer S., J. Wittoeck, W. Appeltans, K. Cooreman, T. Deprez, H. Hillewaert, K. Hostens, J. Mees, E. Vanden Berghe & M. Vincx (2006). The macrobenthos atlas of the Belgian part of the North Sea. Belgian Science Policy. D/2005/1191/3. ISBN 90-810081-6-1. 164 pp.
  6. ^ Zimnes: Echinopluteus larva
  7. ^ Kashenko, S.D., (1994). Larval development of the heart urchin Echinocardium cordatum feeding on different macroalgae. Biologiya Morya, 20, 385-389.
  8. ^ Buchanan, J.B., (1966). The biology of Echinocardium cordatum (Echinodermata: Spatangoidea) from different habitats. Journal of the Marine Biological Association of the United Kingdom, 46, 97-114.
  9. ^ Elements of Marine Ecology
  10. ^ Fish, J.D. and Fish, S., (1996). A student's guide to the seashore. Second edition. Cambridge: Cambridge University Press.
  11. ^ Hayward, P.J. & Ryland, J.S. (ed.) (1995b). Handbook of the marine fauna of North-West Europe. Oxford: Oxford University Press.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Echinocardium australe

Echinocardium australe, or the New Zealand heart urchin is a sea urchin of the family Loveniidae, endemic to New Zealand. Length is up to 40 mm.

Underside view of test of Echinocardium australe

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!