Overview

Comprehensive Description

Biology/Natural History: P. chitonoides is essentially sedentary. The cucumber uses its ten equal tentacles to filter detritus from the water. Sticky pads on each tentacle capture the food particles. The tentacles contain toxic compounds called saponins to discourage fish from nibbling at them. Predators that ignore these chemicals or are not affected by them include Stimpson's Sun Star, the Northern Sun Star, the Leather Star, the Sunflower Star, and the Red Rock Crab. The animals spawn in the spring and a large female may release up to 34,700 eggs. The eggs form a lecithotrophic larvae followed by a pentacula larvae.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Looks like a chiton. Length may be up to 5cm. Shape is like a cucumber that has been sliced in half lengthwise as the ventral side is almost perfectly flat. Ventral side is covered in tube feet. Upper surface is covered with overlapping calcareous plates (resembling a chiton's plates). The mouth is located on the upper surface some distance from the anterior end and is surrounded by bright red oral tentacles.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Geographical Range: Pribilof Islands and Gulf of Alaska to Baja California

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Look Alikes

How to Distinguish from Similar Species: Psolidium bidiscum is more purplish in color and is smaller (only up to 3cm long).
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 11 specimens in 1 taxon.
Water temperature and chemistry ranges based on 5 samples.

Environmental ranges
  Depth range (m): 0 - 205.5
  Temperature range (°C): 10.151 - 10.151
  Nitrate (umol/L): 6.725 - 6.725
  Salinity (PPS): 31.893 - 31.893
  Oxygen (ml/l): 6.561 - 6.561
  Phosphate (umol/l): 0.943 - 0.943
  Silicate (umol/l): 15.658 - 15.658

Graphical representation

Depth range (m): 0 - 205.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 13 specimens in 2 taxa.
Water temperature and chemistry ranges based on 8 samples.

Environmental ranges
  Depth range (m): 62 - 274
  Temperature range (°C): -0.392 - 8.705
  Nitrate (umol/L): 13.007 - 38.842
  Salinity (PPS): 32.561 - 33.763
  Oxygen (ml/l): 2.381 - 6.124
  Phosphate (umol/l): 1.398 - 2.925
  Silicate (umol/l): 21.984 - 90.400

Graphical representation

Depth range (m): 62 - 274

Temperature range (°C): -0.392 - 8.705

Nitrate (umol/L): 13.007 - 38.842

Salinity (PPS): 32.561 - 33.763

Oxygen (ml/l): 2.381 - 6.124

Phosphate (umol/l): 1.398 - 2.925

Silicate (umol/l): 21.984 - 90.400
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth Range: Low intertidal zone to subtidal depths of 247m

Habitat: Rocks in exposed and sheltered inlets.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Psolus chitonoides

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGATGACTTTTTTCCACAAAACATAAGGATATAGGGACTCTATACTTAATATTTGGAACCTGAGCAGGAATGATTGGAACAGCCATGAGAGTCATTATACGTACAGAACTCGCACAACCAGGAGCACTATTAAAAGAT---GACCAAATCTATAAAGTTATAGTAACAGCCCATGCCCTAATAATGATATTCTTTATGGTCATGCCTATAATGATAGGAGGGTTTGGCAAATGATTAATACCTCTAATGATAGGAGCCCCAGACATGGCATTCCCACGAATGAAAAAAATGAGATTCTGACTAGTACCACCATCATTTATTCTTCTTCTTGCTTCAGCAGGAATAGAAAGAGGAGCTGGCACAGGATGAACCATATACCCCCCTCTATCTAGTAAAATAGCCCACGCAGGAGGATCAGTTGATCTCGCTATATTTTCTCTTCACCTAGCAGGCGCTTCCTCTATTCTAGCCTCAATAAAATTCATCACCACCATAATAAAAATGCGAGCACCAGGGATAACACTAGACCGACTACCACTATTTGTATGATCAGTTTTTATAACAGCATTTCTACTAATTTTAAGACTACCAGTATTAGCAGGAGCCATAACAATGTTATTAACAGACCGAAATATAAAAACAACATTCTTTGACCCAGCCGGAGGAGGAGATCCAATACTATTTCAACACTTATTCTGATTCTTTGGCCACCCAGAAGTATACATCCTAATACTCCCAGGGTTTGGAATGATATCCCACATTATAACACACTACAGAGGAAAGAAAGAACCATTTGGATACCTAGGAATGATATATGCCATGATAGCAATAGGAATTTTAGGATTCTTAGTCTGAGCCCACCACATG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Psolus chitonoides

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!