Overview

Comprehensive Description

Biology/Natural History: E. quinquesemita is eaten by the sea stars Solaster stimpsoni and Dermasterias imbricata, and juvenile Eupentacta are a staple food for Leptasterias hexactis. Adults rarely expose their tentacles during daylight hours. Spawning occurs in the spring. Development is indirect, and eggs embryos, and larvae are greenish in color and occur in the Puget Sound plankton from in the spring.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cylindrical, white or cream-colored cucumber about 4-8 cm long. The tube feet are restricted to ambulacra, forming a double row in each radius, strongly supported by skeletal elements and thus relatively rigid and nonretractile. The animal has ten branched, yellow tentacles: eight large and two small.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Geographical Range: Sitka, Alaska to Baja California

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 20 specimens in 1 taxon.
Water temperature and chemistry ranges based on 15 samples.

Environmental ranges
  Depth range (m): -0.5 - 45
  Temperature range (°C): 9.823 - 12.813
  Nitrate (umol/L): 5.744 - 7.608
  Salinity (PPS): 31.893 - 33.344
  Oxygen (ml/l): 5.860 - 6.643
  Phosphate (umol/l): 0.833 - 1.021
  Silicate (umol/l): 7.786 - 15.658

Graphical representation

Depth range (m): -0.5 - 45

Temperature range (°C): 9.823 - 12.813

Nitrate (umol/L): 5.744 - 7.608

Salinity (PPS): 31.893 - 33.344

Oxygen (ml/l): 5.860 - 6.643

Phosphate (umol/l): 0.833 - 1.021

Silicate (umol/l): 7.786 - 15.658
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth Range: Low intertidal to shallow subtidal

Habitat: Under and between rocks and in crevices.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eupentacta quinquesemita

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGATGACTATTTTCAACTAACCACAAGGACATAGGAACCTTATACTTAGTATTTGGTATATGAGCAGGAATGGCAGGAACAGCAATGAGAGTTATTATACGAACAGAACTAGCCCAACCAGGAGCACTACTAAAAGAC---GACCAAATCTACAAAGTTATAGTTACCGCCCACGCTTTAATAATGATATTTTTCATGGTAATGCCCATAATGATAGGAGGGTTTGGAAACTGACTTGTTCCCCTAATGATAGGAGCCCCAGACATGGCATTCCCACGAATGAAAAAAATGAGATTCTGATTAATACCCCCTTCCTTTATTCTTCTACTAGCCTCTGCAAGCGTAGAAAGAGGAGCCGGAACTGGCTGAACAATTTATCCTCCACTATCAAAAAATTTAGCCCATGCAGGAGCTTCAGTTGACCTAGCCATATTCTCTCTTCATCTAGCAGGTGCCTCTTCTATACTTGCATCAATAAAATTTATAACTACAATAATTAACATGCGAACACCAGGTATAACATTTGACCGACTACCTTTATTTGTTTGATCAATTTTTATTACTACATTCTTATTACTTCTTAGACTCCCAGTTCTAGCTGGAGCCATAACAATGTTGTTAACAGACCGTAAAATAAATACAACATTCTTTGACCCAGCTGGAGGAGGAGACCCTATACTATTTCAACACTTATTCTGATTCTTTGGACACCCTGAAGTTTATATTCTTATTCTCCCAGGATTCGGAATGGTCTCCCATATAATTGCACACTACAGAGGAAAGAGAGAACCATTTGGTTACCTAGGCATGGTTTACGCCATGGTTGCTATAGGTATTCTAGGCTTTCTAGTATGAGCCCATCATATG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eupentacta quinquesemita

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!