Overview

Comprehensive Description

Biology/Natural History: [Much of this info is based on papers referring to the species as C. lubrica.] In the Rosario area they often form large, almost continuous aggregations subtidally on rocks such as on areas of Sares Head and Coffin Rocks (photo). The aggregations look like a forest of small dark tentacles surrounded by an expanse of sediment trapped in almost gelatinous mucus. While the aggregations may almost completely cover the surface and individual cucumbers cannot be seen under the sediment-covered mucus, they can easily be isolated by digging a finger into the mass and removing some individuals. The cucumbers suspension feed on small phytoplankton. Besides aggregating (the aggregates are not clones), this species broods the young. The mother cucumber transfers her 1 mm diameter eggs to her ventral surface, where they develop into juveniles. Probably does not feed from October to March, and brooding females do not feeed. Spawning is from November to December on S. Vancouver Island. Males lift their oral ends off the substrate and release long strands of sperm. The sperm sink to the bottom and become entangled in nearby cucumbers. Females lift their oral ends and arch backwards. Eggs roll down the female's ventral surface upon release (many are washed away). She then re-attaches to the rock, holding some eggs beneath her. Eggs are brooded January to March. They hatch in 6 weeks but the female broods the young for another 4-8 weeks. Predators include the seastars Solaster stimpsoni, Solaster dawsoni, Leptasterias hexactis, and Pycnopodia helianthoides. The cucumber does not show an escape response to these stars. The cucumber is toxic to many fish. The saddleback amphipod Parapleustes sp eats the eggs, as does a nematode. The species is parasitized by the gastropod Thyonicola mortenseni.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species has bushy buccal tentacles (characteristic of Order Dendrochirotida) and tube feet which are not all confined to the ambulacral rows, especially on the dorsal side (photo). The ten buccal tentacles are equal in size. The animal is usually dark brown or nearly black. Its mouth and anus are usually slightly upturned. The body wall ossicles are smooth buttons with 4 or more holes (photo). Ossicles in the tube feet are 3-armed rods (photo). Ranges from 1 to 3 cm long.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Geographical Range: Uncertain because of recent taxonomic change. At least from SE Alaska/BC border to Vancouver Island, and probably to central California.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Look Alikes

How to Distinguish from Similar Species: Cucumaria pseudocurata is intertidal, and has tube feet all in rows instead of scattered on the dorsal side. It also usually has 8 large and two small oral (buccal) tentacles and its body ossicles are simple oval, perforated plates. Pseudocnus lubrica (formerly Cucumaria lubrica) looks very similar to this species but usually varies from white to brown with black specks on the dorsal side, plus its ossicles are bumpy, lobed buttons (mitochondrial DNA has also shown it to be a different species).
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 4 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): -1 - 0.1
  Temperature range (°C): 10.151 - 10.151
  Nitrate (umol/L): 6.725 - 6.725
  Salinity (PPS): 31.893 - 31.893
  Oxygen (ml/l): 6.561 - 6.561
  Phosphate (umol/l): 0.943 - 0.943
  Silicate (umol/l): 15.658 - 15.658

Graphical representation

Depth range (m): -1 - 0.1
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth Range: Mostly Subtidal

Habitat: Rocky areas in strong current or surf.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cucumaria curata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

AACCGCTGATTATTTTCAACTAACCACAAGGATATTGGTACACTTTACCTTCTATTTGGAGCCTGAGCAGGAATGGTCGGGACAGCAATGAGAGTAATAATACGAACCGAATTAGCACAACCTGGATCTCTTCTTAAAGAT---GACCAAATATATAAAACCATAGTTACAGCTCACGCACTAGTCATGATATTCTTCATGGTAATGCCTATAATGATAGGAGGATTTGGTAACTGATTAATCCCCCTAATGATAGGAGCCCCCGATATGGCCTTCCCACGAATGAACAACATGAGATTCTGACTAATTCCCCCATCCTTTATACTCCTACTAGCCTCAGCCGGCGTAGAAAAAGGAGCAGGAACAGGATGAACTATTTACCCCCCTCTATCAAGAAAAATAGCCCACGCAGGAGGGTCAGTCGACCTAGCAATATTTTCCCTCCATTTAGCAGGAGCCTCCTCAATCCTCGCCTCCATAAAATTTATTACCACAATTATAAAAATGCGAAGTCCTGGAGTAACCTTTGACCGCCTACCATTATTCGTATGATCAGTCTTCATAACAGCCTTCCTCCTACTACTTAGACTTCCCGTTCTAGCAGGAGCTATAACAATGCTTCTTACAGACCGAAACCTTAAAACATCATTCTTCGACCCCGCAGGAGGAGGAGACCCTATACTATTCCAACACCTATTTTGATTCTTTGGCCACCCAGAAGTATATATCCTTATTCTTCCAGGATTCGGAATGATATCACACGTAATAGCCCACTATAGAGGAAAGCAAGAACCCTTCGGATACTTAGGAATGGTTTACGCAATGGTAGCCATTGGTATTTTAGGATTTCTAGTATGAGCCCACCACATG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cucumaria curata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!