Physical Description

Type Information

Holotype for Pseudarchaster intermedius insignis Verrill, 1895
Catalog Number: USNM 11818
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Collector(s): United States Fish Commission
Year Collected: 1885
Locality: Georges Bank, South Of, Massachusetts, United States, North Atlantic Ocean
Depth (m): 2480 to 2480
Vessel: Albatross R/V
  • Holotype: Verrill. 1895. Am. J. Sci. 49: 132.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Holotype for Pseudarchaster granuliferus Verrill, 1899
Catalog Number: USNM 18448
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Collector(s): United States Fish Commission
Year Collected: 1887
Locality: West Of, Montserrat, Caribbean Sea, North Atlantic Ocean
Depth (m): 1256 to 1256
Vessel: Albatross R/V
  • Holotype: Verrill. 1899. Trans. Conn. Acad. Arts Sci. 10: 192-193, pl.30, fig.6,6a.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 87 specimens in 2 taxa.
Water temperature and chemistry ranges based on 68 samples.

Environmental ranges
  Depth range (m): 0 - 2878
  Temperature range (°C): 1.904 - 26.353
  Nitrate (umol/L): 2.058 - 43.429
  Salinity (PPS): 33.012 - 36.075
  Oxygen (ml/l): 0.796 - 6.629
  Phosphate (umol/l): 0.215 - 3.138
  Silicate (umol/l): 2.109 - 173.583

Graphical representation

Depth range (m): 0 - 2878

Temperature range (°C): 1.904 - 26.353

Nitrate (umol/L): 2.058 - 43.429

Salinity (PPS): 33.012 - 36.075

Oxygen (ml/l): 0.796 - 6.629

Phosphate (umol/l): 0.215 - 3.138

Silicate (umol/l): 2.109 - 173.583
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 2480 - 2480
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pseudarchaster parelii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACGATGATTTTTCTCTACTAAACACAAGGATATTGGCACTCTTTATTTAATATTTGGCGCTTGAGCTGGAATGGTCGGAACCGCAATGAGCGTAATAATTCGCACTGAACTAGCACAACCTGGATCTCTACTCCAAGAT---GACCAAATATACAAAGTAATTGTTACAGCCCACGCACTAATAATGATTTTTTTTATGGTAATGCCCATAATGATTGGCGGATTTGGTAAATGATTAATTCCCCTAATGATTGGTGCTCCCGACATGGCATTTCCCCGAAAGAACAACATGAGCTTTTGACTAATTCCCCCTGCCTTTCTCCTACTAGTAGCCTCCGCTGGAGTTGAAAGAGGAGCTGGGACAGGATGAACAATATACCCCCCCNTNTCCAGAAAACCTGCCCATGCNGGAGGCTCNGTAGATNTTGCCATCTTCTCCGTTCATCTNGGTGGAGCTTCCTCCATCNTNGCATCAATAAAATTTATAACCACCATNATAAATATGCGAACCCCTGCNGTNTCCTTTGACCGCCTACCANTATTTGTATGGTCCGTATTNGTCANTGCCTTTCTCCTTGTATTATCACTCCCCGTTTTAGCTGGCGCTATAACCATGCTCCTTACAGACCGTAATGTAAACACAACCTTCTTTGACCCCGCAGGTGGGGGAGATCCCATTCTATTTCAACACTTATTNTGATTTTTTGGTCACCCTGAAGTTTACATTCTTATCCTCCCAGGATTTGGAATGATATCTCACGTCATAGCCCACTACTCCGGAAAGAGAGAACCCTTCGGATACCTCGGTATGGTCTACGCCATAATATCAATTGGAATTCTAGGTTTTCTAGTTTGAGCCCACCACATGTTCACAGTTGGAATGGATGTTGATACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pseudarchaster parelii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!