Overview

Comprehensive Description

Description

This sea cucumber extends its large red tentacles from muddy sediments. The tentacles are finely branched and may be dark red or lighter pink in colour, becoming white at the tips. The body is white and thick-skinned, covered all over with tube-feet. There are two rings of tentacles; an outer ring of five pairs of large ones and an inner ring of five pairs of small ones. Spicules are absent except in the introvert and tentacles. The ones in the introvert are tables with a perforated disc and delicate spire. Up to 25 cm in length. Thyonidium hyalinum (Fleming, 1828) is similar but smaller with a more transparent skin and spicules with a shorter spire.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Subtidal to more than 200 m, in mud, muddy sand, gravel, probably around the British Isles; known with certainty from Strangford Lough, Isle of Man, Clyde Sea, Shetland
  • Southward, E.C.; Campbell, A.C. (2006). [Echinoderms: keys and notes for the identification of British species]. Synopses of the British fauna (new series), 56. Field Studies Council: Shrewsbury, UK. ISBN 1-85153-269-2. 272 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Recorded from all round the British Isles. Frequent in sea lochs and sheltered sites in W. Scotland.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 51 specimens in 1 taxon.
Water temperature and chemistry ranges based on 26 samples.

Environmental ranges
  Depth range (m): 22 - 190
  Temperature range (°C): 5.655 - 11.782
  Nitrate (umol/L): 6.121 - 17.036
  Salinity (PPS): 33.187 - 35.129
  Oxygen (ml/l): 4.518 - 6.096
  Phosphate (umol/l): 0.511 - 1.316
  Silicate (umol/l): 3.916 - 17.288

Graphical representation

Depth range (m): 22 - 190

Temperature range (°C): 5.655 - 11.782

Nitrate (umol/L): 6.121 - 17.036

Salinity (PPS): 33.187 - 35.129

Oxygen (ml/l): 4.518 - 6.096

Phosphate (umol/l): 0.511 - 1.316

Silicate (umol/l): 3.916 - 17.288
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lives buried in mud usually in sheltered sites and deeper than 20m. Associated with horse mussel beds in Strangford Lough.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Breeding

Large eggs; non-pelagic development
  • Southward, E.C.; Campbell, A.C. (2006). [Echinoderms: keys and notes for the identification of British species]. Synopses of the British fauna (new series), 56. Field Studies Council: Shrewsbury, UK. ISBN 1-85153-269-2. 272 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Thyonidium drummondii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACACTTTACTTAATTTTTGGAGCCTGAGCAGGTCTAATAGGAACAGCTATGAGAGTTATAATTCGAACAGAATTAGCCCAACCAGGCTCTCTTCTCCAAGATGACCAAATTTATAAAGTTATAGTAACTGCTCACGCTCTAGTAATGATATTCTTTATGGTTATGCCCATAATGATAGGGGGCTTTGGAAATTGATTAATCCCCCTCATGATAGGTGCGCCAGATATGGCCTTCCCCCGAATGAAAAAAATGAGATTCTGGCTAGTCCCCCCTTCTTTCATCTTACTTCTAGCCTCAGCAGGAATTGAAAGAGGAGTAGGAACAGGATGAACAATATACCCACCACTCTCAAGTAAAATAGCCCATGCCGGAGGATCAGTAGACTTAGCAATATTCTCTCTGCATCTAGCAGGTGCCTCATCAATCTTAGCCTCAATAAAATTTATAACTACAATTATAAAAATGCGAACGCCAGGAATAAGATTTGACCGATTACCTCTTTTTATATGATCTGTTTTCATAACTGCCTTTCTTCTTCTCCTAAGATTACCAGTACTAGCTGGTGCTATAACAATGTTATTAACTGACCGGAATTTAAAAACAACATTCTTCGACCCTGCCGGCGGCGGAGACCCTATATTATTTCAACACCTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Thyonidium drummondii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!