Ecology

Habitat

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 11 - 11
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Parastichopus parvimensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AGACGCTGACTTTTTTCTACTAAACACAAGGACATTGGTACACTTTACTTAATTTTTGGAGCATGAGCAGGAATGGCTGGAACAGCCATGAGTGTTATTATTCGGACAGAGCTGGCCCAACCAGGCTCCCTTCTTCAAGAC---GACCAAGTTTATAAAGTTGTGGTAACAGCCCACGCTTTAGTTATGATATTCTTTATGGTAATGCCAATAATGATCGGGGGATTTGGAAAATGACTGATTCCTCTAATGATAGGTGCCCCGGACATGGCTTTTCCCCGAATGAAAAAAATGAGATTCTGGTTAATACCTCCCTCCTTTATTCTTCTTCTTGCTTCTGCAGGAGTTGAAAGAGGAGCCGGAACTGGTTGAACAATCTACCCTCCCCTCTCGAGCAATATTGCTCACGCCGGAGGATCCGTTGACCTAGCGATTTTTTCCCTACACTTAGCTGGTGCCTCATCAATTTTAGCTTCCATAAAATTTATCACCACTATCATTAAAATGCGGACCCCAGGTATAACTTTTGACCGACTTCCTCTATTTGTCTGATCCGTTTTCATAACTGCTATTCTCCTTCTTCTAAGCCTTCCAGTTCTAGCTGGTGCCATAACAATGTTACTAACGGACCGGAAAATTAAAACAACTTTTTTTGACCCAGCGGGAGGAGGAGACCCAATTCTATTTCAACACTTGTTCTGATTCTTCGGACACCCGGAAGTTTACATACTGATACTACCTGGCTTTGGTATGATCTCCCACGTTATAGCACACTATAGAGGTAAGCAAGAACCCTTTGGTTATTTAGGTATGGTATATGCCATGGTAGCTATAGGGATACTAGGATTTCTAGTTTGAGCCCACCACATG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Parastichopus parvimensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 3 specimens with morphological vouchers housed at Florida Museum of Natural History and Queensland Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Parastichopus parvimensis

The Warty Sea Cucumber (Parastichopus parvimensis) is a Sea Cucumber that can be found from the Gulf of Alaska to southern California. It is found from the low intertidal zone to a depth of 250 m. They are most abundant in areas with moderate current with cobbles, boulders or bedrock.

Physical description

The Warty Sea Cucumber can grow to a length of 60 cm and a width of 5 cm. It has a soft, cylindrical body, with red-brown to yellowish leathery skin. There are numerous grey spots along its body, hence the name 'warty'. It has an endoskeleton just below the skin. The mouth and anus are on opposite sides of the body. The mouth is surrounded by ten retractable tentacles that are used to bring food in. Five rows of tube feet extend from the mouth to the anus. Mobility is limited, though individuals can move up to 4 m per day while feeding.

Behavior and reproduction

P. parvimensis is a solitary nocturnal animal. It has the ability to regenerate all parts of its body. When threatened, it can expel all its internal organs through its anus and grow new ones. It can also expel sticky filaments to ensnare or confuse predators. It undertakes seasonal migrations to different depths.

These Sea Cucumbers have separate sexes, and eggs are fertilized externally. Spawning usually takes place in November, and each female can produce thousands of eggs. After fertilization, a larva is formed which metamorphoses into a Sea Cucumber after a few weeks.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!