Overview

Distribution

Warty sea cucumbers are found in the Eastern Pacific Ocean along the west coast of North America from Monterey Bay, California to Baja California, Mexico. They are most abundant south of Point Conception, California.

Biogeographic Regions: nearctic (Native ); pacific ocean (Native )

  • Hamel, J., A. Mercier. 2008. Population status, fisheries and trade of sea cucumbers in temperate areas of the Northern hemisphere. Pp. 257-291 in V Toral-Granada, A Lovatelli, M Vasconcellos, eds. Sea Cucumbers, a global review of fisheries and trade., Vol. 516. 2008: FAO. Accessed August 20, 2012 at ftp://ftp.fao.org/docrep/fao/011/i0375e/i0375e09b.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species can be found from Baja California, Mexico to Monterey Bay, California. There are scattered occurrences up to Point Conception in California (Hamel and Mercier 2008). It occurs at depths between 0-60m (Conand 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Warty sea cucumbers are brown or orange and have black-tipped papillae on their ventral surface (giving them their common name). The mouth and anus are on opposite ends of their cylindrical bodies. Warty sea cucumbers can grow to a maximum length of 30-40 cm, but their soft body walls and lack of a skeleton enable these animals to expand and contract significantly. There is no external sexual dimorphism in this species. Average body weight is difficult to estimate because sea cucumbers have the ability to take on sea water as well as eviscerate some of their internal organs periodically during the year, thereby dramatically increasing or decreasing their masses. Generally speaking, their mass is greatest in the winter months due to increased feeding and gonad maturation. They possess tube feet which help them to gather food as well as move across the ocean floor.

Water is pumped in and out of sea cucumber's anus into two specialized breathing apparati known as respiratory trees or water lungs. The base of each tree is connected to the cloaca and oxygenated water is drawn in through this sphincter, with deoxygenated water then being expelled.

Range length: 40 (high) cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

This species is found in rocky and sandy bottom environments beyond the low intertidal zone (down to 30 m), but typically the largest specimens are found in the subtidal zone on sandy bottoms and rock surfaces where there is abundant food (mainly particulate material from under the kelp canopy and granular sediments).

Range depth: 0 to 30 m.

Habitat Regions: temperate ; saltwater or marine

Aquatic Biomes: benthic ; reef ; coastal

Other Habitat Features: intertidal or littoral

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology

P. parvimensis occurs in subtidal habitats on both rocky and soft habitats (Conand 2006). The spawning peak was recorded from February to May in Baja California. The species is found in low energy environments and it is most abundant in area with high organic content. Small individuals in Santa Catalina (California) were seen feeding on fine material collected from rock rubble under kelp. Juveniles (between 2 and 6 cm TL) are found under rocks only, whereas those individuals between 8 and 12 cm can be found both on and under rocks (Hamel and Mercier 2008).

Parastichopus parvimensis does not become sexually mature until it reaches ca. 40 g in total body weight (Muscat 1983). Weight at first maturity was 140 g at Isla Natividad and 120 g at Bahia Tortuga (Fajardo-Leon et al. 2008).This species expresses a definite reproductive cycle with spawning in May and June possibly in response to increasing water temperatures. The gonad is completely reabsorbed during September and October and the gonadal growing phase starts around January. The vitellogenic oocyte reach an average of 180 μm in diameter (Muscat 1983).

Yingst (1982) observed an annual evisceration cycle, which affected 60 % of individuals during October and November, causing them to cease feeding for about four weeks until minimum gut regeneration was accomplished. Muscat (1982) brought evidence of an annual pattern of intestinal growth and development, with sea cucumbers undergoing spontaneous evisceration in September and October. They can regenerate lost parts in one or two months, reaching a maximum overall body weight during the winter, probably due to resumed feeding and accumulation of gonad materials. There are dramatic seasonal fluctuations in population densities, with nearly complete disappearance from shallow water from August to November in Southern California (Muscat 1982). There appears to be a migration downslope from the warmer, shallower areas, which occurs on both hard rock and sand substrates. Eckert et al. (2001) indicates that P. parvimensis begin to settle after 28 days on under sides of rocks and kelp holdfast. Juveniles reached ca. 3.5 cm long after a year of growth.

Larger individuals avoid rocks; they dwell and feed on granular sediments. Densities of sea cucumbers increase on hard substrates, being up to ten times higher than on soft bottoms (Yingst 1982). Nonetheless, the largest specimens are found on sand (Muscat 1982).

Generation length is largely unknown for these species. Body size is not a good indicator of age or longevity. There is some indication, however, that many echinoderms do not go through senescence, but simply regenerate. Therefore generation length cannot be estimated, but is assumed to be greater than several decades (20-40 years) in a natural, undisturbed environment.


Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 11 - 11
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Warty sea cucumbers are detritivores and use oral tentacles and tube feet covered with adhesive mucus to collect debris and sediment. This is passed to the mouth, located within the center of the tentacles, where it is swallowed. After digestion, the remaining non-organic material is eliminated in long fecal castings.

Other Foods: detritus

Primary Diet: detritivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Warty sea cucumbers recycle nutrients and clean the benthic environment when they collect and eat detritus. They rework benthic sediments, oxygenating the top layers and making them more suitable for burrowing infauna. Their feeding activity prevents the buildup of organic decaying material and possibly pathogenic organisms in the sediment environment. Additionally, their eggs, larvae, and juveniles provide food for filter feeders and other species of echinoderms, fish, molluscs, and crustaceans. This species is host to a commensal polynoid scaleworm (Arctonoe pulchra), which may be found living between the sea cucumber's podia, as well as unicellular organisms (Lichnophora macfarlandi and Boveria subcylindrica) that live in its respiratory tree.

Ecosystem Impact: creates habitat; biodegradation

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Young Warty sea cucumbers and larvae are vulnerable to predation by fish and other animals; it is thought that this is why juveniles are typically only found under rocks. It is possible for this sea cucumber species to purposefully and forcefully eviscerate itself to distract predators, regenerating the lost organs later.

Humans consume a variety of sea cucumber species, including Warty sea cucumbers. There is a great demand, particularly in Asian countries, for this species not only as food but for folk medicine applications. It is considered to be widely overfished. This species is also prey for a number of fish, gastropods and crustaceans, as well as sea stars (Pycnopodia helianthoides).

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Sea cucumbers are solitary and do not generally communicate with conspecifics, although they can detect chemicals released during spawning, synchronizing gamete release between animals within the same general area. The podia (tube feet) covering the ventral surface perceive sediment texture as the animal crawls over surfaces.

Communication Channels: chemical

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

After fertilization, the embryo hatches into a free-swimming gastrula within 64 hours. By approximately 14 days post-fertiliztion, the gastrula develops into an auricularia larvae, which ingests phytoplankton. The final larval stage of this sea cucumber is the doliolaria (barrel shaped, non-feeding larvae with ciliary band/s). After approximately 27 days these doliolaria larvae settle onto rocks and algae, metamorphosing into pentacula juveniles. Juveniles grow to 3.5 cm in length within one year and are strictly found under rocks, never on them.

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

There is currently no published information available regarding the lifespan of this species. In general, sea cucumber species are estimated to have a lifespan of 5-10 years in the wild.

Typical lifespan

Status: wild:
5 to 10 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Five stages of gonad development have been identified in this species: Undifferentiated/in repose, gametogenesis, ripe, spawing and post-spawning (similar to other holothurian species). All sea cucumbers are broadcast spawners, with fertilization occurring in the water column. While they are releasing their gametes, sea cucumbers lift the fronts of their bodies, forming an “s-shape”. This position is thought to increase fertilization efficiency.

Mating System: polygynandrous (promiscuous)

Size at sexual maturity of Warty sea cucumbers has been recorded at anywhere between 40 g to 120 g. Gonads begin developing each year around January. Breeding season is typically from May to June and is likely triggered by changes in water temperature or phytoplankton blooms. Gonads are reabsorbed beginning in September.

Breeding interval: Warty sea cucumbers breed once yearly.

Breeding season: Breeding season is typically in the early summer (May/June). Near Santa Catalina Island, spawning occurs in May and June but in Baja, California spawning can begin as early as February.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); broadcast (group) spawning

Because warty sea cucumbers broadcast spawn and larvae develop independently in the water column as plankton, there is no parental investment.

Parental Investment: no parental involvement

  • 2012. "Sea Cucumbers" (On-line). National Geographhic. Accessed April 29, 2012 at http://animals.nationalgeographic.com/animals/invertebrates/sea-cucumber/.
  • Chavez, E. 2011. Stock Assessment of the Warty Sea Cucumber Fishery (Parastichopus parviemnsis) of NW Baja California. CalCOFI Rep., 52: 136-147. Accessed April 29, 2012 at http://calcofi.org/publications/calcofireports/v52/Vol_52_136-147.Chavez.pdf.
  • Fajardo León, M., M. Suarez Higuera, A. del Valle Manriquez, A. Hernandez Lopez. 2008. Biología reproductiva del pepino de mar Parastichopus parvimensis (Echinodermata: Holothuroidea) de Isla Natividad y Bahía Tortugas, Baja California Sur,México. Ciencias Marinas, 34/002: 165-177. Accessed April 29, 2012 at http://redalyc.uaemex.mx/redalyc/pdf/480/48034205.pdf.
  • Hamel, J., A. Mercier. 2008. Population status, fisheries and trade of sea cucumbers in temperate areas of the Northern hemisphere. Pp. 257-291 in V Toral-Granada, A Lovatelli, M Vasconcellos, eds. Sea Cucumbers, a global review of fisheries and trade., Vol. 516. 2008: FAO. Accessed August 20, 2012 at ftp://ftp.fao.org/docrep/fao/011/i0375e/i0375e09b.pdf.
  • Rogers-Bennett, L., D. Ono. 2007. "Status of the Fisheries Report" (On-line). California Department of Fish and Game. Accessed April 29, 2012 at www.nrm.dfg.ca.gov/FileHandler.ashx?DocumentID=34418.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Parastichopus parvimensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

AGACGCTGACTTTTTTCTACTAAACACAAGGACATTGGTACACTTTACTTAATTTTTGGAGCATGAGCAGGAATGGCTGGAACAGCCATGAGTGTTATTATTCGGACAGAGCTGGCCCAACCAGGCTCCCTTCTTCAAGAC---GACCAAGTTTATAAAGTTGTGGTAACAGCCCACGCTTTAGTTATGATATTCTTTATGGTAATGCCAATAATGATCGGGGGATTTGGAAAATGACTGATTCCTCTAATGATAGGTGCCCCGGACATGGCTTTTCCCCGAATGAAAAAAATGAGATTCTGGTTAATACCTCCCTCCTTTATTCTTCTTCTTGCTTCTGCAGGAGTTGAAAGAGGAGCCGGAACTGGTTGAACAATCTACCCTCCCCTCTCGAGCAATATTGCTCACGCCGGAGGATCCGTTGACCTAGCGATTTTTTCCCTACACTTAGCTGGTGCCTCATCAATTTTAGCTTCCATAAAATTTATCACCACTATCATTAAAATGCGGACCCCAGGTATAACTTTTGACCGACTTCCTCTATTTGTCTGATCCGTTTTCATAACTGCTATTCTCCTTCTTCTAAGCCTTCCAGTTCTAGCTGGTGCCATAACAATGTTACTAACGGACCGGAAAATTAAAACAACTTTTTTTGACCCAGCGGGAGGAGGAGACCCAATTCTATTTCAACACTTGTTCTGATTCTTCGGACACCCGGAAGTTTACATACTGATACTACCTGGCTTTGGTATGATCTCCCACGTTATAGCACACTATAGAGGTAAGCAAGAACCCTTTGGTTATTTAGGTATGGTATATGCCATGGTAGCTATAGGGATACTAGGATTTCTAGTTTGAGCCCACCACATG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Parastichopus parvimensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 3 specimens with morphological vouchers housed at Florida Museum of Natural History and Queensland Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Although there are indications that this species is over-exploited, it has no special conservation status at the present time.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

  • IUCN, 2012. "IUCN Red List of Threatened Species. Version 2012.1" (On-line). Accessed August 25, 2012 at www.iucnredlist.org.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2bd

Version
3.1

Year Assessed
2013

Assessor/s
Mercier, A., Hamel, J.-F., Alvarado, J.J., Paola Ortiz, E., Benavides, M. & Toral-Granda, T.-G.

Reviewer/s
Knapp, L., Polidoro, B. & Carpenter, K.E.

Contributor/s

Justification
This species has a small distribution. It is harvested for commercial purposes and has experienced significant declines in portions of its range in the past. It is currently managed under fishing permits in California and there are management proposals for Baja California, Mexico. It has been estimated to have had a population reduction of approximately 50% in Baja California, and a minimum of 30% decline in California, based on exploitation levels in the Channel Islands. It is therefore estimated that a 30-40% decline has occurred across the species' entire range over the past 3 generation lengths and it is therefore listed as Vulnerable.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population

In the Channel Islands of California, densities before the start of the fishery were between 0.2 to 21.1 ind.10 m2 (Schroeter et al. 2001). After the fishery was open, densities were down by 33-83% in the same study area (Schroeter et al. 2001). Between 1983 and 1990, annual landings fluctuated between about 20,000 and 60,000 kg in California. In 1991, over 261,871 kg were harvested. Combined trawl and dive harvest peaked in 1996 at 380,703 kg with an ex-vessel value of USD 582,370 (Rogers-Bennett and Ono 2001). The increase in landings is associated with an increase in an effort, as this is an emerging fishery. There is also a displacement from traditional fisheries that has been banned, including abalone (Rogers-Bennett and Ono 2001).

In Baja California, P. parvimensis has been exploited since the early 1990s, and despite the fact that this species was exploited as much as I. fuscus, its populations have just begun to decline (Bruckner 2006).Densities in Baja California (Mexico), between Puerto Escondido and Punta Abreojos ranged from 0.01 ind/m2 to 0.26 ind/m2 (Fajardo-Leon and Turrubiates-Morales 2009). In another study area of Baja California between Santo Tomas and Santa Rosalita, densities were between 0.175 - 0.821 ind/ m2 (Salgado-Rogel et al. 2009).


Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats

It is harvested throughout its distribution range, usually by divers.

In the state of California, the fishery started in 1978 and focuses on two species: Parastichopus californicus and P. parvimensis. Both diving and targeted trawling are used for the capture, however trawls are restricted mainly to the south of the state and their use has declined over the past few years (Bruckner 2006). In 1997, divers with permits for sea urchins and abalones were allowed to collect sea cucumbers as well (Rogers-Bennett and Ono 2001, Bruckner 2006).

On the west coast of Baja California, the capture of P. parvimensis started in 1989 with 53 tons, and increased rapidly until 1992, when it peaked at 723 tons. In 1996 there was another peak of 637 tons, dropping to 350 tons in the following year. From 1998-2006, the capture was stable between 200-300 tons. During the reported period in this study, there has been a decline of approximately 50% (Salgado-Rogel et al. 2009). Because of high demand and ensuing overexploitation of the species, in 2002-4 it was put under a exploratory fishery scheme (Fajardo-Leon et al. 2008).



Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
U.S. fisheries for this species are closely monitored and permits are required (Bruckner 2005). However, there are no quotas (Rogers-Bennett and Ono, 2001, Schroeter et al. 2001). There were 111 dive permits and 36 trawl permits in 1997 and it declined to 95 divers and 24 trawl permits in 2004 (Bruckner, 2005). Trawling is prohibited in conservation areas around most islands.

In California, since 1992-1993, a special permit has been required for harvesting sea cucumbers, at a cost of USD 250 per year. Permit recipients must have landed a minimum of 20 kg during the previous four-year period. In 1997, separate permits were issued for each gear type, with a limit on the total number of permits issued. A maximum of 111 dive permits and 36 trawl permits were issued in 1997, and this declined to 95 dive permits and 24 trawl permits in 2004. There are no restrictions on catch, but trawling is prohibited in the Trawl Rockfish Conservation Areas (water from 30 fathoms to 150-250 fathoms (depending on latitude) along the mainland coast, shoreline to 200 fathoms around most islands, except the Farallon Islands, where the fishery is closed from the shoreline to 10 fathoms) (CDF&G, 2005). Other trawl fisheries have a total trip limit of 136 kg of bycatch, which includes sea cucumbers.

There is currently no management program in Baja California. There is a fishery management proposal for Baja California, consisting of one closed season from February to May to protect the reproductive season, and another from August to October to protect the internal organs when these are absent or atrophied (Fajardo-Leon et al. 2008). There is another proposal to close fishery areas where densities are below 0.2 ind/m2 (Salgado-Rogel et al. 2009).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no known adverse effects of Warty sea cucumbers on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Warty sea cucumbers are almost exclusively harvested by divers and shipped to Asian markets in China, Hong Kong, Taiwan, and South Korea; they are sold for consumption and folk medicine uses. Their dried body walls are known as "bêche-de-mer." While there is limited information on their basic biology and stock abundance on the west coast of North America, there is evidence showing that these organisms are overfished.

Positive Impacts: food ; source of medicine or drug

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Parastichopus parvimensis

The Warty Sea Cucumber (Parastichopus parvimensis) is a Sea Cucumber that can be found from the Gulf of Alaska to southern California. It is found from the low intertidal zone to a depth of 250 m. They are most abundant in areas with moderate current with cobbles, boulders or bedrock.

Physical description[edit]

The Warty Sea Cucumber can grow to a length of 60 cm and a width of 5 cm. It has a soft, cylindrical body, with red-brown to yellowish leathery skin. There are numerous grey spots along its body, hence the name "warty." It has an endoskeleton just below the skin. The mouth and anus are on opposite sides of the body. The mouth is surrounded by ten retractable tentacles that are used to bring food in. Five rows of tube feet extend from the mouth to the anus. Mobility is limited, though individuals can move up to 4 m per day while feeding.

Behavior and reproduction[edit]

P. parvimensis is a solitary nocturnal animal. It has the ability to regenerate all parts of its body. When threatened, it can expel all its internal organs through its anus and grow new ones. It can also expel sticky filaments to ensnare or confuse predators. It undertakes seasonal migrations to different depths.

These Sea Cucumbers have separate sexes, and eggs are fertilized externally. Spawning usually takes place in November, and each female can produce thousands of eggs. After fertilization, a larva is formed which metamorphoses into a Sea Cucumber after a few weeks.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!