Overview

Distribution

Range Description

This Caribbean species occurs from the southeastern U.S. and the Gulf of Mexico, south to Colombia and Venezuela, and east to Jamaica, Dominican Republic, Puerto Rico, Cuba, Panama and Bahamas. It is found at depths between 1-37m (Miller and Pawson 1984).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In Panama this species has been recorded from Bocas del Toro, Caribbean Sea.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Coppard , Simon

Source: The Echinoderms of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

References and links

Sluiter, C. P. (1910). Westindische Holothurien. Zool. Jahrb. Jena Suppl. 11: (331-342).

Pawson, D. L., D. J. Vance, C. G. Messing, F. A. Solis-Marin, and C. L. Mah. (2009). Echinodermata of the Gulf of Mexico, Pp. 1177–1204 in Felder, D.L. and D.K. Camp (eds.), Gulf of Mexico–Origins, Waters, and Biota. Biodiversity. Texas A&M Press, College S.

Alvarado, J.J., F.A. Solis-Marin & C. Ahearn. (2008). Equinodermos (Echinodermata) del Caribe Centroamericano. Rev.Biol.Trop. 56 (Suppl. 3): 37-55.

Barcode of Life

GenBank

World Register of Marine Species

LSID urn:lsid:marinespecies.org:taxname:241780


Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Coppard , Simon

Source: The Echinoderms of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Synonymised taxa

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Coppard , Simon

Source: The Echinoderms of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology

This species prefers soft bottoms with muddy or sandy patches, in and around Thalassia seagrass beds (Miller and Pawson 1984, Toral-Granda 2008). It is also found in areas of calcareous algae (Miller and Pawson 1984), and prefers deeper, calmer reef environments (Hendler et al. 1995).


Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 9 specimens in 1 taxon.
Water temperature and chemistry ranges based on 7 samples.

Environmental ranges
  Depth range (m): 11 - 162
  Temperature range (°C): 22.312 - 26.768
  Nitrate (umol/L): 0.615 - 6.773
  Salinity (PPS): 36.143 - 36.740
  Oxygen (ml/l): 3.478 - 4.895
  Phosphate (umol/l): 0.054 - 0.661
  Silicate (umol/l): 1.232 - 2.986

Graphical representation

Depth range (m): 11 - 162

Temperature range (°C): 22.312 - 26.768

Nitrate (umol/L): 0.615 - 6.773

Salinity (PPS): 36.143 - 36.740

Oxygen (ml/l): 3.478 - 4.895

Phosphate (umol/l): 0.054 - 0.661

Silicate (umol/l): 1.232 - 2.986
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Astichopus multifidus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

AGGGTTTGGAAACTGATTAATCCCACTCATGATCGGAGCTCCAGACATGGCCTTCCCACGAATGAAAAACATGAGATTTTGATTAGTACCACCCTCTTTTATCCTTTTACTGGCCTCAGCAGGCGTAGAAAGAGGTGCAGGTACAGGATGAACCATCTACCCACCATTATCCAGAAAAATAGCCCATGCCGGAGGGTCTGTAGACCTAGCAATATTCTCTTTACACCTAGCCGGAGCATCTTCAATTCTGGCCTCAATAAATTTCATCACAACAGTGATAAAAATGCGAACTCCTGGGATTTCCTTTGACCGACTCCCGTTATTTGTGTGATCAGTTTTTATAACCGCAATATTACTCCTATTAAGACTACCGGTATTAGCCGGAGCCATAACTATGCTTCTCACAGACCGAAAAATTAAAACCACTTTCTTCGACCCAGCAGGAGGAGGAGACCCCATACTATTTCAACACCTTTTCTGATTCTTTGGACACCCAGAAGTCTACATTCTAATATTACCCGGGTTTGGAATGATTTCCCACGTAATAGCCCACTATAGAGGAAAGCAAGAGCCTTTTGGTTACTTAGGAATGGTATACGCCATGGTAGCTATAGGAATATTAGGCTTTCTAGTATGAGCACACCACATGTTTACGGTTGGTATGGACGTAGACACCACGAGCA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Astichopus multifidus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
Toral-Granda, T.-G., Alvarado, J.J., Benavides, M., Paola Ortiz, E., Hamel, J.-F. & Mercier, A.

Reviewer/s
Elfes, C., Tognelli, M. & Knapp, L.

Contributor/s

Justification

This species has a wide distribution and has been important in fisheries in Panama, Venezuela, and Nicaragua. In Panama, Costa Rica, and Venezuela, all sea cucumber fishing activities are banned. However, illegal fishing may occur in Panama. There is no fishing information from other parts of its range and no evidence that it is fished. It is therefore listed as Least Concern.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The average density reported for this species in Bocas del Toro, Panama (4.9 individuals per ha) may indicate current critical overfishing levels. The estimated size of the total population in that area was 231,000 individuals (Guzman and Guevara 2002). This species was absent in 95% of protected areas around Cayos Zapatillas in Panama (Guzman and Guevara 2002).

Along the eastern and central Yucatan coast (Mexico) a density of 5.92 individuals per ha was found in the east and 32.18 individuals per ha in the central coast. The total biomass was estimated at approximately 16,000 tonnes for an area of approximately 1.2 million hectares (Moguel et al. 2003).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats

Although not one of the most valuable species for fishery purposes, it can be expected that this species may become more popular after the depletion or reduction of other species of higher commercial importance and value. It can be considered an emerging commercial species, because higher value Indo-Pacific species are becoming scarce.

A stock assessment of this species conducted by Guzman and Guevara (2002) suggests that if the fishing pressure from 1997 is maintained, the population of this species in Boca del Toro, Panama would collapse in nine days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

In Panama, Costa Rica, and Venezuela, all sea cucumber fishing activities are banned (Toral-Granda 2008). Illegal fishing may occur in Panama (J. Alvarado pers. comm. 2010). The fishery for this species in Nicaragua is unregulated. The distribution of this species overlaps with some protected areas.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Astichopus

Astichopus is a monotypic genus of sea cucumbers, the only species in the genus being Astichopus multifidus. It is commonly known as the furry sea cucumber or the fissured sea cucumber and is native to the Caribbean Sea.

Description[edit]

Astichopus multifidus is a robust, soft-bodied species growing to a maximum length of 40 cm (16 in) and width of 10 cm (4 in). Both its dorsal and ventral surfaces are uniformly covered with hundreds of tube feet, those on the dorsal surface being extended into papillae, fleshy conical projections about 1 cm (0.4 in) long with tube feet at their tips. This sea cucumber is chocolate brown or dark grey, sometimes mottled with paler patches or speckled with many small white spots.[3][4]

Distribution and habitat[edit]

Astichopus multifidus is native to the Caribbean region. Its range includes the West Indies, the southern tip of Florida, the Dry Tortugas and the region of the Campeche Bank and southwards to Colombia and Venezuela.[4][5] It is found on sandy seabeds near reefs and occasionally in seagrass meadows, at depths ranging between 10 and 30 m (33 and 98 ft).[4]

Biology[edit]

Astichopus multifidus spends the day buried in the sand, emerging at night to feed. It is a scavenger and detritivore and ingests large quantities of sediment from which organic matter is extracted as it passes through its gut. It can move much more rapidly than most sea cucumbers and can cover almost 2 m (6 ft) in a minute.[4] Locomotion is mostly by crawling or rolling, but fast progress can be made by "bounding".[4]

Status[edit]

The IUCN has rated Astichopus multifidus as being of "Least Concern". Other species of sea cucumber found in the Caribbean have been more heavily exploited than this species, but as stocks get depleted, it can be expected to be increasingly targeted. The population trend of Astichopus multifidus is unknown but its range includes some protected areas, and the gathering of sea cucumbers is illegal in Panama, Costa Rica and Venezuela.[6]

References[edit]

  1. ^ Paulay, Gustav (2013). "Astichopus Clark, 1922". World Register of Marine Species. Retrieved 2014-03-16. 
  2. ^ Paulay, Gustav (2013). "Astichopus multifidus (Sluiter, 1910)". World Register of Marine Species. Retrieved 2014-03-16. 
  3. ^ De Kluijver, M.; Gijswijt, G.; de Leon, R.; da Cunda, I. "Furry sea cucumber (Astichopus multifidus)". Interactive Guide to Caribbean Diving. Marine Species Identification Portal. Retrieved 2014-03-16. 
  4. ^ a b c d e Colin, Patrick L. (1978). Marine Invertebrates and Plants of the Living Reef. T.F.H. Publications. p. 431. ISBN 978-0-86622-875-6. 
  5. ^ "Astichopus multifidus: Fissured sea cucumber". Encyclopedia of Life. Retrieved 2014-03-16. 
  6. ^ Toral-Granda, T.-G.; Alvarado, J.J.; Benavides, M.; Paola Ortiz, E.; Hamel, J.-F.; Mercier, A. (2013). "Astichopus multifidus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 2014-03-17. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!