Overview

Comprehensive Description

Biology/Natural History: Feather stars are primarily suspension feeders. They may walk around using the cirri or swim if dislodged using the arms. Feather stars are deepliving and rarely seen in the Pacific Northwest. Juveniles are stalked like the stalked crinoids (sea lilies).
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feather stars are echinoderms structured somewhat like an upside-down brittle star. The 5 arms often fork near the base to form a total of 10 or more arm branches which are often around 10 cm long. Jointed appendages called pinnules branch from the side of the arms, giving the featherlike appearance. The upper (oral) surface of the arms has an ambulacral groove, and both the mouth and the anus are on the upper side of the central disk. In feather stars (Order Comatulida), the aboral side of the central disk has clawlike cirri which function somewhat like bird feet to grasp the substrate. Tan to reddish tan. Armspread to 25 cm.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

> "As with other species of echinoderms, this species can regenerate parts of the body that have been damaged. A single arm amputated at the base regenerated to a functional one within nine months. The Sunflower Star (Pycnopodia helianthoides) and the Decorator Crab (Oregonia gracilis) prey on this crinoid, and are thought to cause it to cast off its arms as a defense."
*See "Reproduction and Life History" for more information

> "The parasitic flatworm Fallocohospes inchoatus inhabits the intestine of F. serratissima.”

> "The name serratissima is from the Latin serratus, meaning ‘saw teeth.’ "
(Lambert & Austin, 2007, p. 18)

  • Lambert, P. & Austin, W. C. (2007). Brittle Stars, Sea Urchins and Feather Stars of British Columbia, Southeast Alaska and Puget Sound. Victoria: Royal BC Museum.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: gspence

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Natividad Island, Baja California, N to the Shumagins and Sannak Island, Alaska. Depth range: 11-1,252 m.
  • Clark AH, Clark AM (1967) A monograph of the existing crinoids 1(5). Bulletin of the United States National Museum (82):1-860.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This species is recorded from the eastern Pacific coast of Panama (see Maluf, 1988).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Coppard , Simon

Source: The Echinoderms of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographical Range: Northern Alaska to Mexico or farther south to off South America.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

"Shumagin and Sannak islands, Alaska, to Natividad Island, Baja California: 11-1252 metres" (Lambert & Austin, 2007, p. 17).

  • Lambert, P. & Austin, W. C. (2007). Brittle Stars, Sea Urchins and Feather Stars of British Columbia, Southeast Alaska and Puget Sound. Victoria: Royal BC Museum.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: gspence

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

"The most common species in British Columbia and southeast Alaska, possessing the basic comatulid body plan...
Arms: Ten, 150-280 mm long; first pinnule 17-21 mm long with 45-60 joints; third pinnule 20 mm with 36 joints; distal pinnules long and slender, their joints overlapping. Syzygies between brachials 3-4, 9-10, 16-17, and after that every three muscular articulations... Each arm has approximately 440 pinnules.
Cirri: 40-50 large and stout, about 30 mm long with about 36 joints; nearly all the cirrals bear dorsal spines.
Colour: Overall yellow, brownish-yellow, tan or reddish-brown; cirri whitish to light brown; pinnules brown to black" (Lambert & Austin, 2007, p. 16).
  • Lambert, P. & Austin, W. C. (2007). Brittle Stars, Sea Urchins and Feather Stars of British Columbia, Southeast Alaska and Puget Sound. Victoria: Royal BC Museum.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: gspence

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Diagnosis

Florometra with third syzygy usually between brachials 16+17 (sometimes 15+16). Basal pinnulars of oral pinnules markedly carinate and appearing much broader than rest of pinnule especially in lateral view. Longest cirrals with L/W ratio not more than 2. Longest proximal brachials distinctly broader than long.
  • Clark AH, Clark AM (1967) A monograph of the existing crinoids 1(5). Bulletin of the United States National Museum (82):1-860.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Synonymised taxa

Antedon serratissima A. H. Clark, 1907

Heliometra serratissima (A. H. Clark, 1907)

Antedon perplexa A. H. Clark, 1907

Florometra perplexa (A. H. Clark, 1907)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Coppard , Simon

Source: The Echinoderms of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

References and links

Clark, A. H. (1907), Descriptions of new species of recent unstalked Crinoids from the North Pacific Ocean. Proceedings of the United States National Museum 33(1559): 69-84.

Maluf, L. Y. (1988). Composition and distribution of the central eastern Pacific echinoderms. Natural History Museum of Los Angeles County Technical Reports, 2, 1– 242.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Coppard , Simon

Source: The Echinoderms of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

How to Distinguish from Similar Species: This is the only feather star likely to be encountered in our region.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

"Similar Species: Florometra asperrima is almost identical in general appearance to F. serratissima except it tends to be more yellow in colour, larger and the third syzygy is between brachials 14-15 instead of 16-17. Charles Messing thinks that these two species may be the same" (Lambert & Austin, 2007, p. 17).

  • Lambert, P. & Austin, W. C. (2007). Brittle Stars, Sea Urchins and Feather Stars of British Columbia, Southeast Alaska and Puget Sound. Victoria: Royal BC Museum.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: gspence

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 3373 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3322 samples.

Environmental ranges
  Depth range (m): 46 - 3233.96
  Temperature range (°C): 1.622 - 9.769
  Nitrate (umol/L): 20.014 - 44.880
  Salinity (PPS): 33.614 - 34.664
  Oxygen (ml/l): 0.346 - 3.775
  Phosphate (umol/l): 1.586 - 3.298
  Silicate (umol/l): 20.855 - 177.025

Graphical representation

Depth range (m): 46 - 3233.96

Temperature range (°C): 1.622 - 9.769

Nitrate (umol/L): 20.014 - 44.880

Salinity (PPS): 33.614 - 34.664

Oxygen (ml/l): 0.346 - 3.775

Phosphate (umol/l): 1.586 - 3.298

Silicate (umol/l): 20.855 - 177.025
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth Range: 10-1252 m. This species is mostly found in quite deep water but can be found as shallow as 10 m in some restricted localities such as some places in southern British Columbia.

Habitat: Soft and hard bottoms

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dispersal

"At least six species of sea stars and two sea anemones cause Florometra serratissima to swim for short bursts of 10 to 30 seconds. Locomotion is by a sequential repetition of arm strokes in three groups of arms. The initial response raises the animal about 30 cm off the substrate, then it swims horizontally with mouth foremost at a mean speed of 6.8 cm per second..." (Lambert & Austin, 2007, p. 18).

“...Continuous swimming beyond 4 min provokes a refractory period lasting 5–17 min during which individuals are incapable of swimming. Spontaneous swimming was never observed in situ [undisturbed] nor in aquaria, but was elicited by mechanical stimulation or contact with potential predators. Trials with 17 co-occurring invertebrate species of diverse feeding modes show that swimming is provoked by opportunistic carnivores, notably asteroids. Swimming is an escape response against potential predators. Crawling is the primary means of moving from place to place. Crawling is induced by directional currents and by intraspecific contact...” (Shaw & Fontaine, 1990).

  • Lambert, P. & Austin, W. C. (2007). Brittle Stars, Sea Urchins and Feather Stars of British Columbia, Southeast Alaska and Puget Sound. Victoria: Royal BC Museum.
  • Shaw, G. D. & Fontaine, A. R. (1990). The locomotion of the comatulid Florometra serratissima (Echinodermata: Crinoidea) and its adaptive significance [Abstract]. Canadian Journal of Zoology 68(5). 942-950.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: gspence

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Feeding

"F. serratissima eats particulate matter either drifting up from the sea bottom or suspended in the current. Tube feet situated along the ambulacral food grooves of the pinnules initially collect food particles. The arms and pinnules orient at right angles to the flow of water, with the groove facing down current. Each tube foot is covered with numerous papillae that produce mucus and have sensory hair-like cilia at their tips. The tube feet occur in triplets that alternate with those on the opposite side of the groove. The primary (longest) tube feet project out to the side of the pinnule and are exposed to the passing current, the shorter secondary tube feet are more vertical and the tertiary tube feet lie across the food groove. The primary tube foot snares food particle with its sticky surface and flicks the particle to the groove but it will also wipe itself under the curled tertiary tube foot, whose papillae act like a comb. The particles are moved down the groove by cilliary action and eventually reach the mouth" (Lambert & Austin, 2007, p. 17).

“The feeding behaviour of the comatulid crinoid Florometra serratissima (A. H. Clark) was studied at two sites around Vancouver Island. It appears to inhabit areas where currents are slight. The arms are held in a cone posture during slack water but in mild currents they orient to form a partial arm fan.
Tube foot behaviour was observed in situ [undisturbed] and in aquaria. The podia [arms] arise in groups of three, each podium of the triplet exhibiting a characteristic behaviour related to its role in feeding. The primary podia are typically held extended; they initiate the mechanism of particle capture, secrete mucous threads, and are sensory. The secondary podia, attached to the lappet [flap] for much of their length, scoop to collect particles and perhaps mucous threads. The tertiary podia manipulate material in the food grooves. Lappet action appears to aid particle collection through scraping along the primary podia. These feeding activities are compared with those reported for Antedon bifida (Pennant) and other crinoids” (Byrne & Fontaine, 1981).

  • Lambert, P. & Austin, W. C. (2007). Brittle Stars, Sea Urchins and Feather Stars of British Columbia, Southeast Alaska and Puget Sound. Victoria: Royal BC Museum.
  • Byrne, M. & Fontaine, A. R. (1981). The feeding behaviour of Florometra serratissima (Echinodermata: Crinoidea) [Abstract]. Canadian Journal of Zoology, 59(1). 11-18.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: gspence

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

"...The mature adults release gametes through nipple like swellings on the distal surface of each genital pinnule. Individual females ovulate about 23,800 eggs for a period of about three days each month. The eggs of this and other crinoids are small (around 200 µm) compared to other echinoderms that have non-feeding larvae. Sperm fertilize the eggs in open water and development begins with radial cleavage.
Thirty-five hours after fertilization the young larva (doliolaria) breaks through the fertilization membrane surrounding the egg. By four days, the larva has transverse bands of hair-like cilia for swimming and an adhesive pit at the front end for attaching to the substrate. Soon after this, the larva begins to explore the sea bottom for a place to settle, which could happen right away or be delayed by up to nine days...
Once settled and attached to the substrate, the larva undergoes some rapid changes and resembles a small stalked crinoid (the cystidean stage), although it does not have a mouth yet. About 16 days after settlement, when the larva is about 1.8 mm tall, another transformation takes place. Plates and tube feet begin to form in the mouth region and the animal (in its pentacrinoid stage) begins to feed. It survives in this form for at least six months. Although the transformation into a free-living form has not been observed, in other species of crinoid the hook-like cirri develop around the top of the stalk then the animal detaches from the stalk and leaves it behind" (Lambert & Austin, 2007, p. 18).
  • Lambert, P. & Austin, W. C. (2007). Brittle Stars, Sea Urchins and Feather Stars of British Columbia, Southeast Alaska and Puget Sound. Victoria: Royal BC Museum.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: gspence

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Regeneration

“Rate of arm regeneration was measured in caged specimens of the stalkless crinoid Florometra serratissima (A. H. Clark) with one, two, three, and five amputated arms. A single arm amputated at the base regenerates to a fully functional condition in under 9 months. Contrary to earlier speculation, the rate of regeneration per arm decreases slightly as the number of regenerating arms on an individual increases. However, the total rate of regeneration of new arm tissue on an individual increases with increasing number of regenerating arms. An arm amputated midway regenerates at a rate similar to that of an arm amputated near the base. In the population of F. serratissima under study, just under 80% of the individuals had at least one regenerating arm. The potential causes of arm loss are considered and some observations are presented which suggest that the sea star Pycnopodia helianthoides and the crab Oregonia gracilis will attack this feather star and cause it to autotomize arms” (Mladenov, 1983).

  • Mladenov, P. V. (1983). Rate of arm regeneration and potential causes of arm loss in the feather star Florometra serratissima (Echinodermata: Crinoidea) [Abstract]. Canadian Journal of Zoology, 61(1). 2873-2879.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: gspence

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Florometra serratissima

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGCAATTAAGTCGTTGGTTGTTTTCTACAAATCATAAGGATATTGGTACTTTGTATTTTCTTTTTGGTGCTTGGGCTGGTATGGTTGGCACTGCTTTAAGAATTATAATTCGTACAGAGTTATCTCAACCTGGTTCTTTTTTAGGAGATGATCAAATTTATAAAGTAATTGTAACTTCTCATGCTTTAATAATGATTTTTTTTATGGTAATGCCAATAATGATAGGTGGTTTTGGTAATTGATTAATTCCTTTAATGATAGGAGCTCCTGATTTGGCTTTTCCTCGTGTAAAAAAAATGAGTTTTTGGTTACTTCCTCCTTCTTTTCTTCTTTTATTAGCTTCTGCTGGTGTAGAAAGGGGTGCTGGTACAGGTTGGACTATTTATCCTCCTTTATCAAGTGGTTTAGCACATTCTGGAGGTTCTGTTGATCTTGCTATTTTTTCTTTACATATTGCTGGTGCTTCTTCTATTGTTGCTTCTATAAATTTTATTACAACTGTAATAAAAATGCGCTCTCCGGGGGTTACTTTTGATCGTTTGCCTTTATTTGTTTGATCTGCTTTTATTACGGCTTTTCTTCTTTTATTATCTCTTCCAGTTTTAGCTGGTGCTATAACTATGCTTCTTACTGATCGTAATATTAATACTACTTTTTTTGATCCGGCTGGTGGTGGTGATCCTATTTTATTTCAGCATTTATTTTGATTTTTTGGTCATCCTGAGGTTTATATTCTTATTTTACCTGGTTTTGGTATGATTTCTCATGTTGTAGCTCACTATTCTGGTAAGCAGGAACCTTTTGGGTATTTAGGAATGGTTTATGCTATGGTTGCTATAGGAATTTTAGGTTTTCTTGTTTGGGCTCATCATATGTTTACAGTTGGGATGGATGTGGATACTCGTGCTTATTTTACAGCAGCTACTATGATAATAGCTGTTCCTACTGGAATAAAGGTTTTTAGGTGAATGGCAACTTTACAGGGTTCTAATATTCGTTGAGATGTTCCTTTGTTTTGGGCTTTAGGTTTCATTTTTTTATTTACTTTAGGTGGTTTAACGGGTGTTGTTCTTTCTAATTCTAGTTTAGATATAGTTCTTCATGATACTTATTATGTAGTAGCTCATTTTCATTATGTTCTTTCTATGGGTGCTGTTTTTGCTATTTTTTCTGGTTTTACTCATTGATTTCCTTTATTTTCTGGTGTAGGTTTTCATCCTCAATTAAGAAAGGTTCAATTTTTTATTATGTTTATTGGTGTTAATCTTACTTTTTTTCCTCAACATTTTTTAGGTTTGGCTGGTATGCCTCGTCGTTATGCTGATTATCCTGATGCTTATGTTAGCTGAAATTTAGTTTCTTCTATTGGTTCTATTATTTCTTTAGTTGCTGTTATTTTTTTTATTTTTTTAGTTTGAGAAGCTTTTGTAGTTCGTCGGAGTGTTTTATTACCTAGATATGTAAGTTCTTCTTTAGAATGACAATATAGTTTTTTTCCTCCATCCCACCATACATATAATGAGACTCCTTTTGTTGTTTTAATTAATTCTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Florometra serratissima

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 23
Specimens with Barcodes: 25
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Observed trend

“Apparently the tendency to develop spines increases with the increasing temperature of the habitat.”

  • Clark, A. H. & Clark, A. M. (1967). Smithsonian Institution United States National Museum Bulletin 82: A Monograph of the Existing Crinoids, 1. 301.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: gspence

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!