Ecology

Habitat

Depth range based on 217 specimens in 3 taxa.
Water temperature and chemistry ranges based on 67 samples.

Environmental ranges
  Depth range (m): 0 - 170
  Temperature range (°C): 0.364 - 14.476
  Nitrate (umol/L): 1.070 - 29.820
  Salinity (PPS): 31.546 - 35.239
  Oxygen (ml/l): 5.446 - 8.585
  Phosphate (umol/l): 0.189 - 2.401
  Silicate (umol/l): 0.693 - 63.273

Graphical representation

Depth range (m): 0 - 170

Temperature range (°C): 0.364 - 14.476

Nitrate (umol/L): 1.070 - 29.820

Salinity (PPS): 31.546 - 35.239

Oxygen (ml/l): 5.446 - 8.585

Phosphate (umol/l): 0.189 - 2.401

Silicate (umol/l): 0.693 - 63.273
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Asterias amurensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGCAACTAAGACGCTGACTATTTTCTACTAAACATAAGGACATTGGGACTCTTTATCTAATATTTGGAGCTTGAGCTGGTATGATTGGAACTGCTATGAGAGTAATAATTCGTACTGAGCTCGCACAACCGGGATCTTTACTTCAAGATGATCAAATTTACAAAGTTATAGTAACTGCTCATGCTCTTGTAATGATATTTTTTATGGTGATGCCTATTATGATAGGAGGATTTGGTAAATGACTAATTCCTCTTATGATAGGTGCCCCAGATATGGCATTTCCCCGCATGAAAAAAATGAGATTTTGACTAATCCCCCCTTCTTTCTTACTCCTCCTAGCTTCCGCTGGAGTTGAAAGAGGAGCTGGAACTGGCTGAACGATTTATCCTCCTTTATCTAGAGGACTAGCTCATGCAGGAGGATCCGTTGATCTTGCTATCTTTTCTTTACATTTGGCAGGGGCTTCTTCTATTTTAGCCTCTATAAAATTTATTACAACAATTATCAAAATGCGAACTCCTGGTATGTCTTTTGATCGACTTCCTCTTTTTGTATGATCAGTATTTGTAACTGCTTTTCTTCTACTACTTTCTCTTCCTGTTTTAGCTGGAGCTATTACTATGCTCTTAACAGACCGAAAAGTTAATACAACTTTTTTCGACCCTGCTGGAGGAGGGGACCCCATACTTTTTCAACATTTATTCTGATTTTTTGGACACCCTGAAGTTTATATTCTTATTCTTCCTGGATTTGGAATGATCTCTCACGTGATAGCACACTACGCAGGTAAGAATGAACCTTTTGGTTATTTAGGAATGGTCTACGCAATAATCTCCATAGGGATTTTGGGATTTCTTGTATGAGCTCACCATATGTTTACTGTTGGGATGGACGTAGATACTCGGGCTTACTTTACTGCCGCTACTATGATTATAGCTGTCCCTACCGGGATTAAGGTATTTAGTTGAATGGCCACCCTACAGGGAAGAAAACTACGATGGGATACTCCTCTTCTTTGAGCACTAGGATTTGTATTTTTATTTACCATAGGAGGACTAACCGGAGTGGTTTTAGCTAATTCTTCCATTGATATAATTCTTCACGACACATACTACGTTGTTGCCCACTTTCACTACGTATTATCCATGGGGGCCGTCTTTGCAATATTTGCTGGCTTTACCCACTGGTTTCCACTATTTTCTGGAGTAAGCTTACACCCCCTATGAAGAAAGGTTCATTTTGCGGTAATGTTTATAGGCGTTAACCTTACTTTCTTCCCTCAACATTTTTTAGGTTTAGCCGGAATGCCCCGACGTTATTCCGACTACCCAGATGCTTATACCTTGTGAAATACAGTTTCTTCTATTGGTTCCACAATTTCTTTAATAGCCACCCTCATATTTTTATTTTTAATTTGGGAAGCCTTCTTACTAAGTCACACGGCCTCTCCACCCAGAGTCTCTACCTCTTCCTTAGAATGACAATACTCTTCTTTTCCCCCTTCACATCACACTTTTGAAACTCCCTCTACTGTATACTTGATTAAGTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Asterias amurensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Asterias amurensis

Asterias amurensis, also known as the Northern Pacific seastar and Japanese common starfish, is a seastar native to the coasts of northern China, Korea, Russia and Japan.[1] This species has been introduced to the oceanic areas of Tasmania, southern Australia, Alaska, the Aleutian Islands, parts of Europe, and Maine.[1] Based on the distribution of northern Pacific seastar populations in shipping ports and routes, the most likely mechanism of introduction is the transport of free-swimming larvae in ballast water for ships. The ships suck in the ballast water containing seastar larvae, in a port such as one in Japan, and let it out in a port such as one in Tasmania, the larvae come out with the water, and metamorphose into juvenile sea stars.

It has become an invasive species in Australia and is on the Invasive Species Specialist Group list of the world's 100 worst invasive species.[2]

Impacts on Society[edit]

Invasions breed extinctions. It is vital to monitor ecological impacts from invasive species, because they can cause economic or even human health impacts. A surge in this species’ population will affect the populations of its prey and throw off normal balances in the current trophic web of Pacific coast areas. Experimental evidence has concluded that the predatory star has a major impact on juvenile bivalves. The asteroid will also attach itself to salmon traps, oyster lines and scallop longlines.[3] In Australia, it was connected to the decline of the endangered handfish. American ecologists must pay close attention to the implications of this invasive species. As trophic webs change over time, the endangerment and loss of certain marketable sea organisms cause coastal communities to potentially lose billions of dollars. In Japan, the sea star’s population outbreaks have cost the mariculture industry millions of dollars in control measures and losses from predation.[3]

Removal[edit]

The North Pacific sea star has already invaded Australian waters in the Derwent Estuary and Henderson Lagoon. Such a notable disturbance has not been documented in America.[citation needed]

Trials have been run to find effective removal processes including physical removal of A. amurensis, which was estimated by workshop participants to be the most effective, safe and politically attractive when compared with chemical or biological control processes.[4] Poisoning the seastars or introducing a new predator to cut back their population numbers would introduce new problems, so effectiveness is not guaranteed. Early detection and prevention of reproduction remains the best solution to reducing harmful effects of invasive species. The aim of the study by Mountfort et al. was to develop a probe to test ballast water and detect the presence of this specific maritime pest.[5] If policies on removal of ballast water are enforced, the star will not be introduced to foreign systems so frequently.

See also[edit]

References[edit]

  1. ^ a b Shah, Foram and Shikha Surati (2013). "Asterias amurensis". Animal Diversity Web. Retrieved 2013-06-19. 
  2. ^ "100 of the World's Worst Invasive Alien Species". Global Invasive Species Database. Retrieved 16 July 2010. 
  3. ^ a b Stevens, Chantal. "Asterias amurensis (seastar)". Global Invasive Species Database. Retrieved 2013. 
  4. ^ Thresher, Ronald E.; Armand M. Kuris (2004). "Options for managing invasive marine species". Biological Invasions 6: 295–300. doi:10.1023/b:binv.0000034598.28718.2e. 
  5. ^ Mountfort, Douglas; Lesley Rhodes, Judy Broom, Melissa Gladstone & John Tyrrell (2007). "Fluorescent in situ hybridization assay as a species-specific identifier of the northern Pacific seastar, Asterias amurensis". New Zealand Journal of Marine and Freshwater Research 41: 283–290. doi:10.1080/00288330709509915. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Northern Pacific seastar

The Northern Pacific starfish (Asterias amurensis.

The Northern Pacific starfish, (Asterias amurensis) is an invasive species in Australia. The starfish is native to the coasts of northern China, North Korea, South Korea, Russia and Japan and distribution of this species into other countries has increased. It is on the Invasive Species Specialist Group list of the world's 100 worst invasive species.[1]

Reproduction

In Australia spawning occurs from July to October at temperatures of 10°C to 12°C. Fertilized eggs develop into free-swimming larvae that live in the water for around 90 days before settling and metamorphosing into juvenile seastars. In one year the northern Pacific seastar is capable of increasing its diameter by 8 cm; when fully grown the northern Pacific seastar lives up to five years, and can reach sizes up to 40 to 50 cm in diameter. Larval survival is constrained by temperature and salinity of the surrounding marine habitat, with the optimal ranges respectively 8°C to 16°C, and 3‰ to 8.75‰. Generally, seastars are sensitive to salinity fluctuations, and are unlikely to be found in places of high salinity. In Japan its numbers increase and reach outbreak proportions for two to three years; outbreaks have been found to occur in three or ten year cycles. Native to the coasts of northern China, Korea, Russia and Japan, the northern Pacific seastar lives in waters between 7 °C and 22 °C. It lives in mainly shallow water, but also is found as deep as 200 metres. It is rarely found on reefs or high wave action areas, instead sitting on mud, sand or pebbles.

In Tasmania, due to the plague of these seastars, hunting days have been organized, where volunteers work together to physically remove as many of the seastars as possible. Efforts of this kind in 1993 resulted in the collection of more than 30,000 seastars. During the first attempts to remove the seastar from Tasmania, many of the seastars that were captured were cut up and thrown back into the sea. Unfortunately, each part that was thrown back was able to regenerate and grow a new seastar as long as it had part of the central disc remaining.

Seastar poisons are not specific and in the ocean, could damage many other natural marine communities. Also, the amount of chemicals needed to poison seastars in estuaries would be uneconomical, and very impractical. In Australia, northern Pacific seastars don't have any pathogens, though in Japan, northern Pacific seastars are attacked by a unicelled animal called Orchitophrya. Orchitophrya invades seastars' testes, kills sperm, and castrates the seastar. However scientists later discovered that Orchitophrya doesn't usually invade all 10 of the seastar's testes and doesn't have the effect hoped for.

The northern Pacific seastar has also been found in Port Phillip Bay, Victoria, for some years now. The seastar has migrated inland in the Maribyrnong River, reaching as far inland as Essendon. The Maribyrnong is a salty river (previously known as Saltwater River), but finding the seastar this far inland is unusual.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!