Overview

Distribution

Northern Pacific sea stars are found throughout parts of the Pacific Ocean near Japan, Russia, Northern China, and Korea as a native species. However, this species has also been introduced to oceanic habitats near parts of the southern Australian coast (especially Tasmania), Alaska and the Aleutian Islands, Europe, and the state of Maine.

Biogeographic Regions: nearctic (Introduced ); palearctic (Native ); australian (Introduced ); atlantic ocean (Introduced ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Northern Pacific sea stars have five arms, all ending in small, upward-turned tips. Each of these arms joins in the center of the organism to form a central disc. This species shows a wide range of colors, from orange to yellow, and sometimes purple on their dorsal side. Irregularly arranged spines run down the length of each arm. A row of spines from each arm come together near the mouth area, creating a fan-like appearance. Spines also line the ventral groove of each arm, where the tube feet are found. This species can grow to be up to 50 cm in diameter.

Range length: 50 (high) cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry ; radial symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Northern Pacific sea stars live in estuarine, intertidal, and coastal zones and prey on other marine inhabitants in or on the substrate. They are found near protected areas of coasts, far away from areas of the ocean with high wave action, at depths up to 220 meters. They prefer a slightly cold environment of about 7-10ºC; however, this species has adapted to the warmer waters of the Australian coast, which average about 22ºC. It can survive in a temperature range of 0–25ºC. Due to their presence in estuarine habitats, these sea stars are able to tolerate a large range of salinities, from 18.7-41.0 ppt.

Range depth: 220 (high) m.

Habitat Regions: temperate ; saltwater or marine

Aquatic Biomes: benthic ; coastal ; brackish water

Other Habitat Features: estuarine ; intertidal or littoral

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 217 specimens in 3 taxa.
Water temperature and chemistry ranges based on 67 samples.

Environmental ranges
  Depth range (m): 0 - 170
  Temperature range (°C): 0.364 - 14.476
  Nitrate (umol/L): 1.070 - 29.820
  Salinity (PPS): 31.546 - 35.239
  Oxygen (ml/l): 5.446 - 8.585
  Phosphate (umol/l): 0.189 - 2.401
  Silicate (umol/l): 0.693 - 63.273

Graphical representation

Depth range (m): 0 - 170

Temperature range (°C): 0.364 - 14.476

Nitrate (umol/L): 1.070 - 29.820

Salinity (PPS): 31.546 - 35.239

Oxygen (ml/l): 5.446 - 8.585

Phosphate (umol/l): 0.189 - 2.401

Silicate (umol/l): 0.693 - 63.273
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Northern Pacific sea stars are known to be voracious predators with a varied diet, essentially eating any type of animal that they encounter. Bivalves, such as mussels, scallops and clams compromise the largest part of this species' diet. They are known to pull apart the shell of these organisms with their arms, and then evert their stomachs into the shell cavity to digest their prey. This species also preys on gastropods, crabs, and barnacles. Occasionally, they have been seen exhibiting cannibalistic behavior when food sources are particularly low. This species has also been observed digging out buried prey from under the substrate, and feeding on algae.

Animal Foods: mollusks; aquatic crustaceans; echinoderms

Plant Foods: algae

Primary Diet: carnivore (Eats non-insect arthropods, Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Northern Pacific sea stars are an invasive species in some areas and an obligate predator whose presence has a great impact on benthic infauna, including mollusks, crustaceans, echinoderms, and other organisms that are preyed upon by this sea star. This species is known to host the bacterium Colwellia asteriadis, although negative effects on the sea star due to the presence of this microbe have not been described.

Commensal/Parasitic Species:

  • Choi, E., H. Kwon, H. Koh, Y. Kim, H. Yang. 2010. Colwellia asteriadis sp. nov., a marine bacterium isolated from the starfish Asterias amurensis. International Journal of Systematic and Evolutionary Microbiology, 60/8: 1952-1957.
  • The National System for the Prevention and Management of Marine Pest Incursions. National Control Plan for the Northern Pacific Seastar Asterias amurensis. Australia: Commonwealth of Australia. 2008. Accessed March 20, 2012 at http://www.marinepests.gov.au/__data/assets/pdf_file/0010/952489/Asterias-ncp-08.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Northern Pacific sea stars are not generally preyed upon by other organisms. However, they may occasionally be eaten by Japanese sun stars (Solaster paxillatus). In Alaska, king crabs are known to feed on this species, and in laboratory settings, snails in the genus Charonia (tritons) have shown a preference for this species, as opposed to feeding on other marine life.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Northern Pacific sea stars are able to perceive light stimuli and are positively phototactic. As previously mentioned, when four of five arms are shaded, a sea star will move with its illuminated ray forward. All other documented information about the communication and perception abilities of these sea stars regards sensory interactions between larval and adult forms. Larvae are capable of sensing metamorphosis inducing factors expelled by adults via use of neural cells that are held within the adhesive papillae on the external surface of the brachiolar arms.

Communication Channels: chemical

Perception Channels: visual ; tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Male and female sea stars release their respective gametes in to the aquatic environment. The gametes come together to form a fertilized egg, which undergoes holoblastic and radial cleavage followed by gastrulation, completing the beginning stages of larval development. The larva begins to feed once the gastrovascular canals are formed, and at this stage is called a bipinnaria. This stage later develops brachiolar arms, with three of them combining with a central adhesive disk to form the brachiolar complex. This marks the transition of the larva into the brachiolaria state. A brachiolarian larva can remain in the water column for about 120 days before it finally settles and undergoes metamorphosis into the adult sea star. Metamorphosis is induced by the detection of metamorphic inducing factors by the adhesive papillae on the brachiolar arms, such as chemical cues from adult sea stars in the environment. It takes a larva as little as 41 days to about 120 days, from the time of fertilization, to develop into an adult sea star. This process is all dependent upon the temperature of the water in which the sea star is developing; the warmer the water, the faster the rate of development.

Development - Life Cycle: metamorphosis

  • Paik, S., H. Park, S. Yi, S. Yun. 2005. Developmental duration and morphology of the sea star Asterias amurensis in Tongyeong, Korea. Ocean Science Journal, 40(3): 65-70.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

The average lifespan of a sea star is around 10 years, although many sea star species are able to live to about the age of 50. There is no specific information available regarding the lifespan of Northern Pacific sea stars.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Female Northern Pacific sea stars release their eggs into the surrounding marine environment; they are then externally fertilized by sperm released by male sea stars. This species reproduces seasonally and spawns during the months of January to April in Japan and during the months of June to October in Russia and Australia.

Mating System: polygynandrous (promiscuous)

Sexual maturity occurs in both males and females when they are 3.6-5.5 cm in length. Females can be identified for 5-6 months of the year due to the presence of their maturing ovaries. Mature ovaries are characterized by the constant release of eggs as well as their orange color. Females are capable of carrying about 10-25 million eggs. Males are also reproductively mature for about 6 months of the year, with maturity being characterized by the yellowish-brown color of the testes. These sea stars have ectosomatic organs, meaning that the pores for gamete expulsion are in direct contact with the marine environment. As gametes are released, they are replaced by constantly ongoing gametogenesis within the gonads. Spawning usually occurs in the late winter and early spring months, continuing into the summer.

Breeding interval: This species has an annual breeding season, during which individuals may spawn several times.

Breeding season: Spawning usually occurs in the late winter to early spring.

Range number of offspring: 10,000,000 to 25,000,000.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; asexual ; fertilization (External ); broadcast (group) spawning; oviparous

Gametes are released freely into the environment, and offspring develop independently of the parents.

Parental Investment: no parental involvement

  • 2012. "Asterias amurensis (Japanese seastar)" (On-line). The National Introduced Marine Pest Information System- NIMPIS. Accessed March 18, 2012 at http://adl.brs.gov.au/marinepests/index.cfm?fa=main.spDetailsDB&sp=6000005721#generalInfo.
  • Byrne, M., M. Morrice, B. Wolf. 1997. Introduction of the Northern Pacific asteroid Asterias amurensis to Tasmania: reproduction and current distribution. Marine Biology, 127(4): 673-685.
  • Murabe, N., H. Hatoyama, K. Mieko, H. Kaneko, Y. Nakajima. 2007. Adhesive papillae on the brachiolar arms of brachiolaria larvae in two starfishes, Asterina pectinifera and Asterias amurensis, are sensors for metamorphic inducing factors(s). Development, Growth, and Differentiation, 49(8): 647-656.
  • Paik, S., H. Park, S. Yi, S. Yun. 2005. Developmental duration and morphology of the sea star Asterias amurensis in Tongyeong, Korea. Ocean Science Journal, 40(3): 65-70.
  • Stevens, C. 2012. "ISSG Database: Ecology of Asterias amurensis" (On-line). Global Invasive Species Database. Accessed March 18, 2012 at http://www.issg.org/database/species/ecology.asp?si=82&fr=1&sts=&lang=EN.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Asterias amurensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGCAACTAAGACGCTGACTATTTTCTACTAAACATAAGGACATTGGGACTCTTTATCTAATATTTGGAGCTTGAGCTGGTATGATTGGAACTGCTATGAGAGTAATAATTCGTACTGAGCTCGCACAACCGGGATCTTTACTTCAAGATGATCAAATTTACAAAGTTATAGTAACTGCTCATGCTCTTGTAATGATATTTTTTATGGTGATGCCTATTATGATAGGAGGATTTGGTAAATGACTAATTCCTCTTATGATAGGTGCCCCAGATATGGCATTTCCCCGCATGAAAAAAATGAGATTTTGACTAATCCCCCCTTCTTTCTTACTCCTCCTAGCTTCCGCTGGAGTTGAAAGAGGAGCTGGAACTGGCTGAACGATTTATCCTCCTTTATCTAGAGGACTAGCTCATGCAGGAGGATCCGTTGATCTTGCTATCTTTTCTTTACATTTGGCAGGGGCTTCTTCTATTTTAGCCTCTATAAAATTTATTACAACAATTATCAAAATGCGAACTCCTGGTATGTCTTTTGATCGACTTCCTCTTTTTGTATGATCAGTATTTGTAACTGCTTTTCTTCTACTACTTTCTCTTCCTGTTTTAGCTGGAGCTATTACTATGCTCTTAACAGACCGAAAAGTTAATACAACTTTTTTCGACCCTGCTGGAGGAGGGGACCCCATACTTTTTCAACATTTATTCTGATTTTTTGGACACCCTGAAGTTTATATTCTTATTCTTCCTGGATTTGGAATGATCTCTCACGTGATAGCACACTACGCAGGTAAGAATGAACCTTTTGGTTATTTAGGAATGGTCTACGCAATAATCTCCATAGGGATTTTGGGATTTCTTGTATGAGCTCACCATATGTTTACTGTTGGGATGGACGTAGATACTCGGGCTTACTTTACTGCCGCTACTATGATTATAGCTGTCCCTACCGGGATTAAGGTATTTAGTTGAATGGCCACCCTACAGGGAAGAAAACTACGATGGGATACTCCTCTTCTTTGAGCACTAGGATTTGTATTTTTATTTACCATAGGAGGACTAACCGGAGTGGTTTTAGCTAATTCTTCCATTGATATAATTCTTCACGACACATACTACGTTGTTGCCCACTTTCACTACGTATTATCCATGGGGGCCGTCTTTGCAATATTTGCTGGCTTTACCCACTGGTTTCCACTATTTTCTGGAGTAAGCTTACACCCCCTATGAAGAAAGGTTCATTTTGCGGTAATGTTTATAGGCGTTAACCTTACTTTCTTCCCTCAACATTTTTTAGGTTTAGCCGGAATGCCCCGACGTTATTCCGACTACCCAGATGCTTATACCTTGTGAAATACAGTTTCTTCTATTGGTTCCACAATTTCTTTAATAGCCACCCTCATATTTTTATTTTTAATTTGGGAAGCCTTCTTACTAAGTCACACGGCCTCTCCACCCAGAGTCTCTACCTCTTCCTTAGAATGACAATACTCTTCTTTTCCCCCTTCACATCACACTTTTGAAACTCCCTCTACTGTATACTTGATTAAGTAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Asterias amurensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

This species hs no special conservation status.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

The negative economic effects of Northern Pacific sea stars are extensive. In their native Japan, they have devastated the shellfish industry. In Australia, the economic effects of the species are still being fully evaluated, but it is thought that if their spread continues, the soft sediment communities along the coast of Australia may be compromised. It is evident that several fisheries have been negatively impacted – there has been an estimated one billion dollar loss in the industry in Tasmania. Because these fishing industries are important to the economy of the region, several “sea star hunting days” have been organized in which several thousand sea stars have been removed from the coasts. Northern Pacific sea stars are also on the Global Invasive Species Database's list of the 100 Worst Invasive Species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

There are no known positive economic effects of Asterias amurensis on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Asterias amurensis

Asterias amurensis, also known as the Northern Pacific seastar and Japanese common starfish, is a seastar native to the coasts of northern China, Korea, Russia and Japan.[1] This species has been introduced to the oceanic areas of Tasmania, southern Australia, Alaska, the Aleutian Islands, parts of Europe, and Maine.[1] Based on the distribution of northern Pacific seastar populations in shipping ports and routes, the most likely mechanism of introduction is the transport of free-swimming larvae in ballast water for ships. The ships suck in the ballast water containing seastar larvae, in a port such as one in Japan, and let it out in a port such as one in Tasmania, the larvae come out with the water, and metamorphose into juvenile sea stars.

It has become an invasive species in Australia and is on the Invasive Species Specialist Group list of the world's 100 worst invasive species.[2]

Impacts on Society[edit]

Invasions breed extinctions. It is vital to monitor ecological impacts from invasive species, because they can cause economic or even human health impacts. A surge in this species’ population will affect the populations of its prey and throw off normal balances in the current trophic web of Pacific coast areas. Experimental evidence has concluded that the predatory star has a major impact on juvenile bivalves. The asteroid will also attach itself to salmon traps, oyster lines and scallop longlines.[3] In Australia, it was connected to the decline of the endangered handfish. American ecologists must pay close attention to the implications of this invasive species. As trophic webs change over time, the endangerment and loss of certain marketable sea organisms cause coastal communities to potentially lose billions of dollars. In Japan, the sea star’s population outbreaks have cost the mariculture industry millions of dollars in control measures and losses from predation.[3]

Removal[edit]

The North Pacific sea star has already invaded Australian waters in the Derwent Estuary and Henderson Lagoon. Such a notable disturbance has not been documented in America.[citation needed]

Trials have been run to find effective removal processes including physical removal of A. amurensis, which was estimated by workshop participants to be the most effective, safe and politically attractive when compared with chemical or biological control processes.[4] Poisoning the seastars or introducing a new predator to cut back their population numbers would introduce new problems, so effectiveness is not guaranteed. Early detection and prevention of reproduction remains the best solution to reducing harmful effects of invasive species. The aim of the study by Mountfort et al. was to develop a probe to test ballast water and detect the presence of this specific maritime pest.[5] If policies on removal of ballast water are enforced, the star will not be introduced to foreign systems so frequently.

See also[edit]

References[edit]

  1. ^ a b Shah, Foram and Shikha Surati (2013). "Asterias amurensis". Animal Diversity Web. Retrieved 2013-06-19. 
  2. ^ "100 of the World's Worst Invasive Alien Species". Global Invasive Species Database. Retrieved 16 July 2010. 
  3. ^ a b Stevens, Chantal. "Asterias amurensis (seastar)". Global Invasive Species Database. Retrieved 2013. 
  4. ^ Thresher, Ronald E.; Armand M. Kuris (2004). "Options for managing invasive marine species". Biological Invasions 6: 295–300. doi:10.1023/b:binv.0000034598.28718.2e. 
  5. ^ Mountfort, Douglas; Lesley Rhodes, Judy Broom, Melissa Gladstone & John Tyrrell (2007). "Fluorescent in situ hybridization assay as a species-specific identifier of the northern Pacific seastar, Asterias amurensis". New Zealand Journal of Marine and Freshwater Research 41: 283–290. doi:10.1080/00288330709509915. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Northern Pacific seastar

The Northern Pacific starfish (Asterias amurensis.

The Northern Pacific starfish, (Asterias amurensis) is an invasive species in Australia. The starfish is native to the coasts of northern China, North Korea, South Korea, Russia and Japan and distribution of this species into other countries has increased. It is on the Invasive Species Specialist Group list of the world's 100 worst invasive species.[1]

Reproduction

In Australia spawning occurs from July to October at temperatures of 10°C to 12°C. Fertilized eggs develop into free-swimming larvae that live in the water for around 90 days before settling and metamorphosing into juvenile seastars. In one year the northern Pacific seastar is capable of increasing its diameter by 8 cm; when fully grown the northern Pacific seastar lives up to five years, and can reach sizes up to 40 to 50 cm in diameter. Larval survival is constrained by temperature and salinity of the surrounding marine habitat, with the optimal ranges respectively 8°C to 16°C, and 3‰ to 8.75‰. Generally, seastars are sensitive to salinity fluctuations, and are unlikely to be found in places of high salinity. In Japan its numbers increase and reach outbreak proportions for two to three years; outbreaks have been found to occur in three or ten year cycles. Native to the coasts of northern China, Korea, Russia and Japan, the northern Pacific seastar lives in waters between 7 °C and 22 °C. It lives in mainly shallow water, but also is found as deep as 200 metres. It is rarely found on reefs or high wave action areas, instead sitting on mud, sand or pebbles.

In Tasmania, due to the plague of these seastars, hunting days have been organized, where volunteers work together to physically remove as many of the seastars as possible. Efforts of this kind in 1993 resulted in the collection of more than 30,000 seastars. During the first attempts to remove the seastar from Tasmania, many of the seastars that were captured were cut up and thrown back into the sea. Unfortunately, each part that was thrown back was able to regenerate and grow a new seastar as long as it had part of the central disc remaining.

Seastar poisons are not specific and in the ocean, could damage many other natural marine communities. Also, the amount of chemicals needed to poison seastars in estuaries would be uneconomical, and very impractical. In Australia, northern Pacific seastars don't have any pathogens, though in Japan, northern Pacific seastars are attacked by a unicelled animal called Orchitophrya. Orchitophrya invades seastars' testes, kills sperm, and castrates the seastar. However scientists later discovered that Orchitophrya doesn't usually invade all 10 of the seastar's testes and doesn't have the effect hoped for.

The northern Pacific seastar has also been found in Port Phillip Bay, Victoria, for some years now. The seastar has migrated inland in the Maribyrnong River, reaching as far inland as Essendon. The Maribyrnong is a salty river (previously known as Saltwater River), but finding the seastar this far inland is unusual.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!