Apostichopus californicus &amp;mdash; Details

Biology/Natural History: P. californicus is the largest sea cucumber species along the Pacific Northwest coast. The species feeds on organic detritus and small organisms, which it ingests with bottom sediments. The primary predators of P. californicus are the sea stars Pycnopodia helianthoides and Solaster endeca, but the species is also occasionally eaten by sea otters and man. Unlike many tropical sea cucumbers, P. californicus does not store substances toxic to predators. The hindgut bears a pair of highly branched diverticula, which project into the coelomic cavity of the body and serve as "water lungs". Oxygenated water is pumped into these respiratory trees in several successive inhalations and then expelled in one powerful exhalation. Breeding occurs in the summer. Development is indirect. The sperm have spherical heads and an unusually low DNA content. The fertilized eggs develop into auricularia larvae which metamorphose into doliolaria larva which settle. The pelagic phase lasts from 7 to 13 weeks in the laboratory. Populations of P. californicus in the Puget Sound eviscerate (photo) during October and November and then regenerate new sets of organs. Evisceration may also occur if the animals are kept in warm or stale water. The scale worm Arctonoe pulchra may occur as a commensal on P. californicus.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Large sea cucumber ranging from 25 to 40cm in body length. Dorsal and lateral surfaces dark red, brown, or yellow. The body surface bears large, stiff, conical papillae or pseudospines. Papillae are usually paler in color than body surface and tipped with red. Tube feet are densely arranged on the ventral side and only three pairs of rows are distinct. The mouth is directed ventrally at the anterior end and is surrounded by tentacles. Length to 50 cm.

Lambert, Philip, 1997. ;Sea Cucumbers of British Columbia, Southeast Alaska, and Puget Sound. ;Royal British Columbia Museum Handbook. ; UBC Press, Vancouver, BC. ;ISSN 1188-5114. ; Paperback, 166 pages. ; This excellent paperbackcontains a key and descriptions to sea cucumbers of our area. ; Themost authoritative general reference to sea cucumbers of our area. http://www.wallawalla.edu/academics/departments/biology/rosario/inverts/Annotated_Bibliography.html#Lambert+1997

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographical Range: Gulf of Alaska to Baja California

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Look Alikes

How to Distinguish from Similar Species: Parastichopus parvimensis, which lives from Monterey Bay south, is very similar in form and can grow to nearly as large, but the body is chestnut brown dorsally and much paler below; plus the tips of its papillae are tipped with black instead of red. Parastichopus leucothele is colored similarly but lives at deeper depths (24-285 m) and is colored bright orange with rusty brown patches and small white papillae.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 132 specimens in 1 taxon.
Water temperature and chemistry ranges based on 66 samples.

Environmental ranges
  Depth range (m): -1 - 5641
  Temperature range (°C): 1.438 - 21.914
  Nitrate (umol/L): 0.088 - 39.811
  Salinity (PPS): 31.856 - 35.219
  Oxygen (ml/l): 0.321 - 6.656
  Phosphate (umol/l): 0.157 - 3.216
  Silicate (umol/l): 1.659 - 139.860

Graphical representation

Depth range (m): -1 - 5641

Temperature range (°C): 1.438 - 21.914

Nitrate (umol/L): 0.088 - 39.811

Salinity (PPS): 31.856 - 35.219

Oxygen (ml/l): 0.321 - 6.656

Phosphate (umol/l): 0.157 - 3.216

Silicate (umol/l): 1.659 - 139.860

Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Public Domain

Source: Ocean Biogeographic Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth Range: Low intertidal zone to 90 m deep

Habitat: Exposed and sheltered areas protected from strong wave action. Subtidal species are found primarily on gravel and shell debris

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Apostichopus californicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Parastichopus californicus

The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 6 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AGACGCTGACTTTTTTCTACTAAACACAAGGACATTGGTACACTTTACTTAATTTTTGGAGCATGAGCAGGAATGGCTGGAACAGCCATGAGTGTTATTATTCGGACAGAACTGGCCCAACCAGGCTCCCTTCTTCAAGAC---GACCAAGTTTATAAAGTTGTGGTAACAGCCCACGCTTTAGTTATGATATTCTTTATGGTAATGCCAATAATGATCGGAGGGTTTGGTAAATGACTAATTCCTCTAATGATAGGTGCCCCAGACATGGCTTTCCCCCGAATGAAAAAAATGAGATTCTGGTTAATACCCCCCTCCTTTATTCTTCTTCTTGCTTCTGCAGGAGTTGAAAGAGGGGCCGGAACAGGTTGAACAATCTACCCTCCCCTCTCGAGCAATATTGCCCACGCAGGGGGATCCGTTGACCTAGCAATTTTTTCCCTACACTTAGCCGGTGCCTCCTCAATTTTAGCCTCCATAAAATTTATTACCACTATTATTAAAATGCGGACCCCAGGTATAACTTTTGACCGACTTCCTTTATTTGTCTGATCCGTTTTCATAACTGCTATTCTTCTTCTTCTAAGCCTTCCAGTTCTAGCCGGTGCAATAACAATGTTATTAACGGACCGGAAAATTAAAACAACTTTCTTTGACCCAGCAGGTGGAGGAGATCCAATACTATTTCAACACTTGTTCTGATTCTTCGGACACCCAGAAGTTTACATATTAATACTCCCTGGCTTTGGTATGATCTCACATGTTATAGCGCACTATAGAGGTAAGCAAGAACCCTTCGGTTATTTAGGTATGGTATATGCCATGGTAGCTATAGGGATACTAGGATTCCTAGTTTGAGCCCACCATATG
-- end --

Download FASTA File

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Parastichopus californicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 9
Species With Barcodes: 1

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Giant California sea cucumber

The giant California sea cucumber (Parastichopus californicus) is a sea cucumber that can be found from the Gulf of Alaska to Southern California. It is found from the low intertidal zone to a depth of 250 m. They are most abundant in areas with moderate current with cobbles, boulders or bedrock.

1 Physical description
2 Feeding habits
3 Behavior and reproduction
4 References

Physical description

The giant California sea cucumber can grow to a length of 50 cm and a width of 5 cm. It has a soft, cylindrical body, with red-brown to yellowish leathery skin. It has an endoskeleton just below the skin. The mouth and anus are on opposite ends of the body. The mouth is surrounded by twenty retractable tentacles that are used to bring food in. Five rows of tube feet extend from the mouth to the anus. Mobility is limited, though individuals can move up to 4 m per day while feeding. They use their tube feet located on the underside of their body.

Feeding habits

Parastichopus californicus at ebb/low tide, Saratoga Passage

The giant California sea cucumber is a scavenger that feeds on plankton and other organic matter. They feed by sifting through sediments with their tentacles, or by positioning themselves in a current where they can use their tentacles to catch food flowing by.

Behavior and reproduction

P. californianus is a solitary nocturnal animal. It has the ability to regenerate all parts of its body. When threatened, it can expel all its stomach contents through its anus until its next feed. It can also expel sticky filaments to ensnare or confuse predators. It undertakes seasonal migrations to different depths.

These sea cucumbers have separate sexes, and eggs are fertilized externally. Spawning usually takes place in August, and each female can produce thousands of eggs. After fertilization, a larva is formed which metamorphoses into a sea cucumber after a few weeks.

References

Benton, William, et al. Britannica Macropaedia. Chicago: Encyclopædia Britannica, Inc, 1976.
Stichpus californicus. NWMarineLife.com, Olympia, Washington. [1]

Wikimedia Commons has media related to: Parastichopus californicus

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5