Overview

Comprehensive Description

Biology/Natural History: P. californicus is the largest sea cucumber species along the Pacific Northwest coast. The species feeds on organic detritus and small organisms, which it ingests with bottom sediments. The primary predators of P. californicus are the sea stars Pycnopodia helianthoides and Solaster endeca, but the species is also occasionally eaten by sea otters and man. Unlike many tropical sea cucumbers, P. californicus does not store substances toxic to predators. The hindgut bears a pair of highly branched diverticula, which project into the coelomic cavity of the body and serve as "water lungs". Oxygenated water is pumped into these respiratory trees in several successive inhalations and then expelled in one powerful exhalation. Breeding occurs in the summer. Development is indirect. The sperm have spherical heads and an unusually low DNA content. The fertilized eggs develop into auricularia larvae which metamorphose into doliolaria larva which settle. The pelagic phase lasts from 7 to 13 weeks in the laboratory. Populations of P. californicus in the Puget Sound eviscerate (photo) during October and November and then regenerate new sets of organs. Evisceration may also occur if the animals are kept in warm or stale water. The scale worm Arctonoe pulchra may occur as a commensal on P. californicus.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Large sea cucumber ranging from 25 to 40cm in body length. Dorsal and lateral surfaces dark red, brown, or yellow. The body surface bears large, stiff, conical papillae or pseudospines. Papillae are usually paler in color than body surface and tipped with red. Tube feet are densely arranged on the ventral side and only three pairs of rows are distinct. The mouth is directed ventrally at the anterior end and is surrounded by tentacles. Length to 50 cm.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is distributed in the Pacific Coast of North America, from the Aleutians Islands, Alaska to Cedros Island, Baja California (Hamel and Mercier 2008). One specimen has been collected from Angel de La Guarda Island, Gulf of California, Mexico (Solis-Marin et al. 2009).

It occurs at depths from 1-250m (Cameron and Fankboner 1986, 1989, Lambert 1997).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographical Range: Gulf of Alaska to Baja California

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Look Alikes

How to Distinguish from Similar Species: Parastichopus parvimensis, which lives from Monterey Bay south, is very similar in form and can grow to nearly as large, but the body is chestnut brown dorsally and much paler below; plus the tips of its papillae are tipped with black instead of red. Parastichopus leucothele is colored similarly but lives at deeper depths (24-285 m) and is colored bright orange with rusty brown patches and small white papillae.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology

This species can be found in the shallow subtidal zone down to 250m, it is found on various types of substrata and various current regimes, however, it is most abundant in areas with moderate currents over cobbles, boulders, shells, sand, crevassed bedrock and algae. It appears to avoids mud bottoms and areas with freshwater runoff (Zhou and Shirley 1996, Woodby et al. 2000, Bruckner 2006, Hamel and Mercier 2008). A preference for harder substrates has been observed (Woodby et al. 2000).

It is a slow moving deposit feeder which collects organic matter and associated micro-organisms (Cameron and Fankboner 1989). This species ceases feeding and becomes dormant between September and early March (Lambert 1997). Adults undergo fluctuations in body mass, body wall thickness, and muscle weight during their annual cycle as they reabsorb and regenerate their internal organs (Fankboner and Cameron 1985, DFO 2002).

This sea cucumber has an annual reproductive cycle and spawning occurs between June and August, and seems to be correlated with bright sunshine days and high phytoplankton productivity (Hamel and Mercier 2008). Recruitment is sporadic in this species and adults have a relatively high natural mortality (Hamel and Mercier 2008).

The larvae feed on plankton and remain in the water column for a period of 35 to 52 days (Lambert 1997). However, Cameron and Fankboner (1989) observed that the pelagic phase could be as long as 65 to 125 days just to reach the auricularia stage and another 2 days were necessary for the pentactula to develop. This suggests that the spawning stock may be quite far from where the larvae settle and grow (Muse 1998). Settlement was observed in dense mats of filamentous red algae, algae holdfast, under rocks or in crevices (Cameron and Fankboner 1989, DFO 2002). The recruitment is sporadic and a high natural mortality rate is suspected (Rogers-Bennett and Ono 2001, Bruckner 2006). Juvenile growth is slow, reaching 0.5 to 2cm after a year and 4 to 10cm after two years (DFO 2002). Sexual maturity is reached after 4 years (Cameron and Fankboner 1989, Lambert 1997). Based on an analysis of length frequency data for the first three years of growth, commercial–sized specimens were estimated to be at least 4 years old; the oldest animals could be around 12 years of age (Cameron and Fankboner 1989).


Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 132 specimens in 1 taxon.
Water temperature and chemistry ranges based on 66 samples.

Environmental ranges
  Depth range (m): -1 - 5641
  Temperature range (°C): 1.438 - 21.914
  Nitrate (umol/L): 0.088 - 39.811
  Salinity (PPS): 31.856 - 35.219
  Oxygen (ml/l): 0.321 - 6.656
  Phosphate (umol/l): 0.157 - 3.216
  Silicate (umol/l): 1.659 - 139.860

Graphical representation

Depth range (m): -1 - 5641

Temperature range (°C): 1.438 - 21.914

Nitrate (umol/L): 0.088 - 39.811

Salinity (PPS): 31.856 - 35.219

Oxygen (ml/l): 0.321 - 6.656

Phosphate (umol/l): 0.157 - 3.216

Silicate (umol/l): 1.659 - 139.860
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth Range: Low intertidal zone to 90 m deep

Habitat: Exposed and sheltered areas protected from strong wave action. Subtidal species are found primarily on gravel and shell debris

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Apostichopus californicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Parastichopus californicus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AGACGCTGACTTTTTTCTACTAAACACAAGGACATTGGTACACTTTACTTAATTTTTGGAGCATGAGCAGGAATGGCTGGAACAGCCATGAGTGTTATTATTCGGACAGAACTGGCCCAACCAGGCTCCCTTCTTCAAGAC---GACCAAGTTTATAAAGTTGTGGTAACAGCCCACGCTTTAGTTATGATATTCTTTATGGTAATGCCAATAATGATCGGAGGGTTTGGTAAATGACTAATTCCTCTAATGATAGGTGCCCCAGACATGGCTTTCCCCCGAATGAAAAAAATGAGATTCTGGTTAATACCCCCCTCCTTTATTCTTCTTCTTGCTTCTGCAGGAGTTGAAAGAGGGGCCGGAACAGGTTGAACAATCTACCCTCCCCTCTCGAGCAATATTGCCCACGCAGGGGGATCCGTTGACCTAGCAATTTTTTCCCTACACTTAGCCGGTGCCTCCTCAATTTTAGCCTCCATAAAATTTATTACCACTATTATTAAAATGCGGACCCCAGGTATAACTTTTGACCGACTTCCTTTATTTGTCTGATCCGTTTTCATAACTGCTATTCTTCTTCTTCTAAGCCTTCCAGTTCTAGCCGGTGCAATAACAATGTTATTAACGGACCGGAAAATTAAAACAACTTTCTTTGACCCAGCAGGTGGAGGAGATCCAATACTATTTCAACACTTGTTCTGATTCTTCGGACACCCAGAAGTTTACATATTAATACTCCCTGGCTTTGGTATGATCTCACATGTTATAGCGCACTATAGAGGTAAGCAAGAACCCTTCGGTTATTTAGGTATGGTATATGCCATGGTAGCTATAGGGATACTAGGATTCCTAGTTTGAGCCCACCATATG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Parastichopus californicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
Mercier, A., Hamel, J.-F., Toral-Granda, T.-G., Alvarado, J.J., Paola Ortiz, E. & Benavides, M.

Reviewer/s
Polidoro, B., Knapp, L., Carpenter, K.E. & Harwell, H.

Contributor/s

Justification
This species is widely distributed and abundant across its range. It is commercially harvested from Alaska to California in a sustainable manner. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population

The Canadian Department of Fisheries and Oceans (DFO 2002) indicates that early southern British Columbia harvesters targeted populations of this species in areas close to the harbour, where diving was easy and the resource abundant. Researchers and managers felt that only a small proportion of the stock was being harvested, and that many sea cucumbers were left untouched in these areas. The fishery therefore expanded to more remote northern areas, but remained targeted on very accessible locations. Still today, large areas of the coast have not been visited by the commercial sea cucumber fleet. Surveys conducted in various areas of the coast indicate that sea cucumber population densities vary considerably with habitat type. Density estimates from almost all surveys are significantly higher than the conservative estimate of 5.08 sea cucumbers per meter of shoreline. This species' populations extend below the safe diving depth of 20m where extensive harvesting cannot be conducted (DFO 2002). In British Columbia, the densities are estimated at less than 0.25ind*m–2 (Bruckner 2006). The CPUE values supplied by Muse (1998) for this species in British Columbia are in kg per diver per hour: 372 in 1983, 347 in 1987 and 617 in 1992.

Woodby et al. (2000) investigated the depth distribution of this species in the vicinity of Sitka Sound, Alaska and found that sea cucumber densities were greatest in shallower waters with ca. 70 percent of the sea cucumbers observed above 15m. Average densities were 0.03ind*m–2 in deeper water and 0.3ind*m–2 at SCUBA diving depths. The deepest sea cucumber was observed at 87m. In Southeast Alaska, Zhou and Shirley (1996) used a submersible to measure densities which varied from 0 to 267ind*ha–1. The highest density recorded was 0.23ind*m–2. Bruckner (2006) reported that harvested sites in California showed densities that were 50–80% lower than in the non-fished areas. For instance, at an established reserve in northern California, densities averaged 2200ind*ha–1. Another set of data from a newly established reserve (Punta Gorda Ecological Reserve) ranged from 250 to 790ind*ha–1, taking into account the large size classes of sea cucumbers exclusively (Rogers-Bennett and Ono 2001, Bruckner 2006). Until 1996, an average of 75 percent of the annual catch came from the trawl fishery in southern California. Between 1997 and 1999, the dive fishery accounted for 80 percent of the take. Recent surveys showed a 50–60 percent decline in abundance between 1994 and 1998, but no correlation was noted between decline in abundance and data on landings. The only increase in abundance (39 percent) was noted at two no-take reserves (Rogers-Bennett and Ono 2001; Schroeter et al. 2001). In California, between 1983 and 1990 annual landings fluctuated between about 20,000 and 60,000kg. In 1991, over 261,871kg were harvested. Combined trawl and dive harvest peaked in 1996 at 380,703kg with an ex-vessel value of USD 582,370 (Rogers-Bennett and Ono 2001).

In Washington State, CPUE from 1983 show that the minimum in those days was around 75kg*diver-1h–1 and the maximum around 130kg*diver-1h–1 (Bradbury 1994). Data recorded in this state at the time clearly demonstrates the impact of the fishery on the stock of sea cucumbers with a decline of up to 70%: sea cucumber densities were around 0.35ind*m–2 before the fishery opened and dropped to 0.1ind*m–2 just after (Bradbury 1994). In Oregon, densities of this species are between 0.1 to 0.22ind*m–2 at depths of 80 to 130m (Bruckner 2006). In Washington, the CPUE between 1995 and 1998 (Bradbury 1999) varied from 56 to a maximum of 80kg*diver-1h–1.


Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats

The commercial sea cucumber fishery in the USA began in the state of Washington and focused on this single species. Between 1971 and 1987, sea cucumbers were harvested by divers without any seasonal or spatial restrictions. In 1987, when depletion of sea cucumber populations became noticeable, the state established harvest districts and a restricted harvest season (ADFG 1990). Today, most of the harvesting is done by hand using SCUBA or hookah, with only limited trawl collections under experimental fishery permits. Collection by divers for personal use/consumption is subject to a daily limit of ten specimens (Bruckner 2005).

In the state of California, the fishery started in 1978 and focused on two species: this species and P. parvimensis. Both diving and targeted trawling are used for the capture, however trawls are restricted mainly to the south of the state and their use has declined over the past few years (Bruckner 2006). In 1997, divers with permits for sea urchins and abalones were allowed to collect sea cucumbers as well (Rogers-Bennett and Ono 2001, Bruckner 2006).

In the state of Alaska, harvesting of this species began in 1981 as an experimental fishery; however the first true commercial landing was recorded in 1983 in Ketchikan (Southern Alaska). Sea cucumbers are collected by SCUBA divers. The fishery was initially not subject to any regulation, and the number of divers increased rapidly when, in 1990, the Alaska Department of Fish and Game closed down the fishery to develop a management plan. In 1995–1996, 424 divers were issued permits in southeast Alaska and this number decreased to 235 in 2001–2002 and 174 in 2006–2007 (Hebert and Pritchett 2002). There is currently a fishery in Kodiak and the Aleutian Islands areas (Ruccio and Jackson 2002).

In the state of Oregon, the fishery began in 1993 targeting this species exclusively (Bruckner 2006). Collection is by SCUBA divers and by trawl with experimental gear permits (Bruckner 2006). Only nine divers requested a permit for the fishery in 1993 even though 44 permits had been made available, whereas 22 divers were recorded in 1994 (Bruckner 2006). The number of harvesters in Oregon after 1994 remained low: five in 1997, two in 1999, one in 2000, two in 2001 and two in 2003 (Bruckner 2005).

This species is the only species fished on the west coast of Canada, the fishery being centered on Vancouver Island in the Georgia and Johnstone Straits and in the Puget Sound. The fishery was an open access through 1990. The number of licenses rose from 40 in 1985 to 215 in 1990. The number of vessels went from 21 in 1985 to 126 in 1990. In 1988, 124 divers where involved and 163 in 1990 (Muse 1998). The fishery in British Columbia expanded rapidly after 1980 with annual landings exceeding 1900 tonnes in 1988. Fishing was initially permitted in the South Coast areas only and the majority of landings were taken in the Strait of Georgia until 1987. The north coast was opened in 1986 with a total annual recommended catch of 500 tonnes, although fishing did not occur there until 1987. To date, landings of sea cucumbers have been recorded from all Canadian Pacific fisheries management areas, with the exception of the North and West Queen Charlotte Islands. The central and north coasts currently support about 80 percent of the fishery (DFO 2002).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

Current sea cucumber management practices in Alaska have provided sustainable harvests and consistent quality. Divers rotate their effort between 16 harvest areas, some of which are divided into more than 20 sub–areas in an effort to maintain sustainability throughout the fishing grounds. In southeast Alaska, each fishing area is run on a three year rotation and harvested at a rate of 6 percent a year (B. Meredith pers. comm.). In any given area that is open for harvest, approximately 18% of the surveyed biomass is removed after which the area will remain closed for the next two years. The Alaskan fishery also closes down during the spawning season (Ruccio and Jackson 2002). Finally, harvest divers can only obtain permits for sea urchins or for sea cucumbers but not both (Bruckner 2006).

In Washington State, the fishery for this species is a year-round dive operation. From 1971 to 1986, the fishery was opened in all areas. However, following signs of overfishing, the Washington State Department of Fisheries implemented a rotational harvest from 1987 to 1992 (Bradbury 1994). Now, the experimental trawl fishery is closed during soft–shell Dungeness crab period and in shrimp areas. For each fished area, the quota is determined using surplus production models and estimates of biomass from catch-effort data, video surveys, and dive surveys. The current management in Washington includes spatial closures, licensing of collectors and an annual quota. Seven area closures for the dive fishery have been established in the current management plan and trawling is prohibited in shrimp areas. Other regulations for trawlers include no fishing in waters less that 20m deep. Divers in Washington need to submit their logbooks every month with data on date, depth, location and amount of captures (Bruckner 2006).

In Oregon, the fishery for this species is conducted by divers. Harvest by trawl required an experimental gear permit until 2003. At present a permit is no longer required (McCrae 1994). In California, both this species and P. parvimensis are harvested. A special permit was required for sea cucumber harvest in 1992–1993. Separate permits for each gear type and a limit on the total number of permit were implemented in 1997. There are no restrictions on catch (Rogers-Bennett and Ono 2001, Schroeter et al. 2001). Bruckner (2005) adds that a maximum of 111 dive permits and 36 trawl permits were issued in 1997, and this declined to 95 divers and 24 trawl permits in 2004. There are no restrictions on catch but trawling is prohibited in some conservation areas and along the shore of most islands (Bruckner 2005).

In British Columbia (Canada), the annual fishery for this species lasts for about three weeks in October, when muscle weight is greatest and the animals have reabsorbed their internal organs (DFO 2002). The commercial fishery is a small limited–entry (i.e. 85 licences) dive fishery that is managed by individual quota (DFO 2002). Of the 85 licences delivered in 2003 in British Columbia, 15 belonged to native peoples. Quotas are calculated by multiplying estimates of shoreline length, sea cucumber density, individual weight and harvest rate (DFO 2002). Only 25% of the coast is open to the commercial fishery. Up to an additional 25% may be used to conduct research, and the remaining 50 % is closed to harvesting until biologically-based management is possible. Abundance surveys and experimental fisheries are being conducted to estimate biomass and evaluate exploitation rate options (DFO, 2002). All landings are monitored by an independent industry-funded firm, dockside landings are only at designated ports, and licence holders pay a fee (Bruckner 2006).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Giant California sea cucumber

The giant California sea cucumber (Parastichopus californicus) is a sea cucumber that can be found from the Gulf of Alaska to Southern California. It is found from the low intertidal zone to a depth of 250 m. They are most abundant in areas with moderate current with cobbles, boulders or bedrock.

Physical description[edit]

The giant California sea cucumber can grow to a length of 50 cm and a width of 5 cm. It has a soft, cylindrical body, with red-brown to yellowish leathery skin. It has an endoskeleton just below the skin. The mouth and anus are on opposite ends of the body. The mouth is surrounded by twenty retractable tentacles that are used to bring food in. Five rows of tube feet extend from the mouth to the anus. Mobility is limited, though individuals can move up to 4 m per day while feeding. They use their tube feet located on the underside of their body.

Feeding habits[edit]

The giant California sea cucumber is a scavenger that feeds on plankton and other organic matter. They feed by sifting through sediments with their tentacles, or by positioning themselves in a current where they can use their tentacles to catch food flowing by.

Behavior and reproduction[edit]

P. californianus is a solitary nocturnal animal. It has the ability to regenerate all parts of its body. When threatened, it can expel all its stomach contents through its anus until its next feed. It can also expel sticky filaments to ensnare or confuse predators. It undertakes seasonal migrations to different depths.

These sea cucumbers have separate sexes, and eggs are fertilized externally. Spawning usually takes place in August, and each female can produce thousands of eggs. After fertilization, a larva is formed which metamorphoses into a sea cucumber after a few weeks.

References[edit]

  • Benton, William, et al. Britannica Macropaedia. Chicago: Encyclopædia Britannica, Inc, 1976.
  • Stichpus californicus. NWMarineLife.com, Olympia, Washington. [1]
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!