Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Terrestrial

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Self-fertilization depression has been found to be strong in this species which is hermpahroditic but prefers to outcross (variation in life history characters is very high and self fertilization does not seem to account for part of this variation) (Dillen et al., 2009).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Succinea putris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTGCGATGACTTTTCTCTACTAATCATAAAGATATTGGAACTTTATATATAATTTTTGGTGTATGAGCTGGTATGATTGGTACAGGGCTTTCTCTCTTAATTCGTTATGAGTTAGGAACATCCGGTATTTTATTGGACGATCATTTATATAATGTTATTGTTACTGCTCATGCTTTTGTTATGATTTTTTTTATAGTTATACCTATTATAATTGGAGGTTTTGGAAATTGAATAGTCCCTTTATTAATTGGCGCACCTGATATAAGTTTTCCCCGAATAAATAATATAAGATTTTGACTTTTACCTCCTTCTTTTATTTTATTATTATGTTCAAGTATGGTAGAAGGAGGAGCTGGAACAGGATGGACTGTATATCCTCCTTTAAGTAGTTTAATTGGGCATAGTGGGGCATCAGTTGATTTAGCTATTTTTTCTCTTCATTTAGCAGGTATTTCTTCTATTTTAGGTGCAATTAATTTTATCACAACAATTTTTAATATACGTCAACTTGGAATAACAATAGAACGATTAAGTTTATTTGTTTGATCTATTTTGGTAACGGTTTTTCTTCTCCTTCTATCTCTTCCTGTTTTAGCAGGTGCTATTACTATACTATTAACTGATCGAAACTTTAATACTTCATTTTTTGATCCTGCAGGTGGTGGTGATCCTATTTTATACCAACATTTGTTTTGATTTTTTGGTCACCCTGAAGTTTATATTTTAATTCTTCCTGGATTTGGGATTGTATCACATATTATTGGAAATCATAGCTTAAAACAACCATTTGGTACTTTAGGTATAATTTATGCAATAGTATCAATTGGGGTTTTAGGGTTTATTGTATGAGCTCATCACATATTTACAGTTGGAATAGATGTTGATACTCGAGCTTATTTTACTGCGGCTACTATAATTATTGCTATTCCTACAGGAATTAAAGTTTTTAGATGATTAATAACTTTATATGGTAGAAATGTAAATTTATCTGCTTCTATATATTGGGTTTTAGGGTTTATTTTTTTGTTTACTTTAGGTGGTTTAACTGGAATTGTCTTAAGAAATTCATCTTTAGATATTATACTACATGATACTTACTATGTAGTAGCCCATTTTCATTATGTTCTTTCTATAGGTGCTGTTTTTGCAATTTTTGCTGGGTTTATTTATTGATTTCCTGTTATAACAGGAATTTTATTAAGTGAACGATTTGCCAAGATTCAATTTTTTATTATATTTTTTGCCGTAAATCTTACTTTTTTCCCTCAACATTTTTTAGGACTTTCGGGAATACCTCGACGATACTCAGATTATCCCGATGCTTACTATAAATGAAACCAAATTTCATCTTTTGGGTCCCTTATATCTGTTTTTGCTGTGGTTTTATTTGTGTTTGTTGTTTGAGAAGCTATGGCTATACAACGACCTTCAATTTTTTCTTTATCTACATCCTCTTCTCGAGAATGGGATGAATTTTTACCTCCAGAATTTCATGGTAATTTAGAATCTTCTGTTACATTAATTAATTATAATTTTAGTACAAATTAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Succinea putris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Succinea putris

Succinea putris is a species of small air-breathing land snail in the family Succineidae, the amber snails.

Distribution[edit]

The distribution of this species is Palearctic, in the European-Siberian region, including the following countries and islands:

Habitat[edit]

This species lives in very damp places, such as on vegetation on river banks and marshes.

Life cycle[edit]

The lifespan of Succinea putris in laboratory conditions is 13 to 17 months.[7]

Parasites[edit]

Succinea putris with the parasitic trematode Leucochloridium paradoxum inside its left tentacle

Parasites and parasitoids of this species include the trematodes Leucochloridium macrostomum and L. paradoxum and the fly Pherbellia punctata.[8]

References[edit]

  1. ^ IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. Downloaded on 25 July 2013.
  2. ^ Juřičková, L., et al. (2001). Check-list of the molluscs (Mollusca) of the Czech Republic. Acta Soc. Zool. Bohem. 65 25-40.
  3. ^ (Dutch) Succinea putris — Anemoon
  4. ^ Balashov, I. and N. Gural-Sverlova. 2012. An annotated checklist of the terrestrial molluscs of Ukraine. Journal of Conchology. 41(1) 91-109.
  5. ^ Georgiev, D. G. (2006). Two new species from the family Succineidae (Beck, 1837) (Gastropoda: Pulmonata) to the fauna of Bulgaria. Scientific Studies of the University of Plovdiv, Biology, Animalia 41 7-11.
  6. ^ Eesti eElurikkus: Succinea putris.
  7. ^ Ðatkauskienë, I. (2005) Characteristic of lifespan and reproduction period of Succinea putris (L.) (Gastropoda: Styllomatophora). Ekologija 3 28-33. (abstract in Lithuanian)
  8. ^ Moor, B. (1980). On the biology of the relationship between Pherbellia punctata (Diptera, Sciomyzidae) and its host Succinea putris (Pulmonata, Stylommatophora). Revue Suisse de Zoologie 87(4) 941-53.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!