Overview

Brief Summary

Introduction

Gonatus middendorffi was described by Kubodera and Okutani (1981) based on a holotype (225 mm ML) and two male paratypes (183, 245 mm DML) with three additional juvenile specimens (40-60 mm ML) collected from the subarctic waters of the northwestern North Pacific. Morphological changes with growth of this species were well described. G. middendorffi is one of a few gonatids that can be identified almost throughout its life.

Nesis (1973, 1997) treated G. middendorffi as a synonym of G. kamtschaticus described by Middendorff in 1849. Based on the original description (Onych. Kamtschatica n. sp. in Middendorff's paper), G. kamtschaticus (24-26 cm ML) has a slender mantle, short fins about 1/3 of body length, long tentacles equal to body length, and the large central club hook is 8mm in length with a distal hook of 4 mm in length.

G. middendorffi specimens of nearly the same size as G. kamtschaticus have relatively larger fins (FL=1/2 ML), shorter tentacles and smaller clubs with much smaller central (ca. 4 mm) and distal hooks (ca. 2mm) on manus than G. kamtschaticus. We consider that G. middendorffi is not synonymous with G. kamtschaticus.

Diagnosis

A Gonatus with ...

  • long slender muscular mantle (MW=18% of ML); small fins (FL=1/2 ML), sagittate with round sides (FW=77% of FL) and long tail (ca. 18% of ML).
  • relatively short arms (AL<1/2 ML), short tentacles and small tentacular club (ca. 12% of ML).
  • central large hook on tentacular club, medium-sized hook distal to central hook and five small suckers some of which are modified into small hooks in a line proximal to the central hook.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Characteristics

  1. Arms
    1. Arms relatively short and thick, muscular.
    2. Arm III longest (50% ML), arm I or IV shortest (87% of arm III).
    3. Arm III with aboral keel and IV with thin lateral keel along their entire lengths.
    4. Number of hooks and suckers on arm III 46-47 and 52, respectively.

      Figure. Ventral view of G. middendorffi (Holotype), 225 mm ML.

  2. Tentacles
    1. Tentacles short, about 1/2 length of ML, slenderer than arms.
    2. Tentacular club remarkably small. about 1/10 of ML.
    3. Club with large central hook and medium sized hook distal to it.
    4. Proximal to large central hook, 5-6 small suckers continue longitudinally.
    5. Suckers of dorsal- and ventral marginal zones of club merge proximally.

    6. Figure. Oral views of the tentacle and club of G. middendorffi, 225 mm ML, holotype. Top - Tentacle. Bottom - Enlargement of the tentacular club. Bar 10 mm. Drawings from Kubodera & Okutani (1981).


      Figure. Oral view of the tentacluar club of G. middendorffi (Holotype), 225 mm ML. Photograph by T. Kubodera.

  3. Head
    1. Head almost squarish in shape, slightly narrower than mantle opening.
    2. Funnel cartilage lanceolate in shape, nuchal cartilage rectangular with three grooves.
    3. Dorsal funnel organ inverted V-shaped, ventral ones large, oval in shape.
    4. Beaks. Information on the beaks of G. middendorffi can be found here.
    5. Radula composed of 5 rows of teeth.

  4. Fins and tail
    1. Fins sagittagte, fin length =1/2 ML, fin width=77% FL.
    2. Tail long, about 15-16% of ML.

  5. Photophores
    1. Photophores absent.

Comments

More details of the description of G. middendorffi can be found here.

We recently found several large Gonatus from stomach contents of a sperm whale caught in the western North Pacific that have a slender mantle with very small fins and a very large central hook with a medium sized distal hook on the manus. Specific characters and localities of the present specimens mostly agree with those of G. kamtschaticus. Although some parts of the squids were damaged by digestion, we are preparing to redescribe G. kamtschaticus in detail based on the specimens we obtained.


Figure. Gonatus cf. kamtschaticus from the stomach contents of sperm whales caught in the western North Pacific, fresh. Upper: dorsal view (ML=20cm), Lower: ventral view (ML=24cm).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Juvenile and immature G. middendorffi are widely distributed in the western part of subarctic waters in the North Pacific including in the western Bering Sea, and a few have been recorded from the Gulf of Alaska. Nesis (1997) mentiond that the geographic range of this speceis (G. kamtschaticus in his paper) is of nerito-oceanic type or intermediate between truly oceanic and nerito-oceanic, because it is pelagic in habit but common in the "nearshore oceanic" zone not far from continental and island slopes and rare in the open ocean.


Figure. Distribution of juvenile and immature G. middendorffi. Dark pink area indicates known range; light pink area indicates inferred range. Chart modified from Okutani, et al. (1988).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

epipelagic
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Life History

Morphological changes with growth of G. middendorffi 6-60mm ML were reported by Kubodera and Okutani (1981). Juveniles of G. middendorffi, larger than 11 mm ML may be identified by the slender, muscular mantle, short arms and long tentacles with a stalk with 4 rows of numerous small suckers proximal to the tentacular club. Paralarvae smaller than 11mm ML are morphologically too close to those of Berryteuthis anonychus. Only the number of teeth on the radula make them distinguishable (5 rows for G. middendorffi, 7 rows for B. anonychus).

Figure. Morphological changes of G. middendorffi with growth. Ventral views of juvenile and immature specimens and oral surface of their tentacles. Drawings from Kubodera and Okutani, 1981.

Paralarvae also can be identified by the dorsal-head chromatophore pattern which is Type I,2 (three tear-shaped chromatophores on each side plus two additional chromatophore in the midline of the head) or Type I,1 since the anterior extra chromatophore was very faint in the large specimen examined, it could be absent in smaller paralarvae; the mantle has 16 dorsal chromatophores (Jorgensen, 2006)

Figure. Dorsal views of the chromatophores of a G. middendorffi paralarva, 19.4 mm ML, Gulf of Alaska. Left - Head. Right - Paralarva. Drawing from Jorgensen (2007).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gonatus kamtschaticus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACATTATATTTTATCTTTGGTATTTGAGCAGGCCTACTAGGAACCTCCCTAAGCCTAATAATTCGAACTGAATTAGGACAACCTGGATCTCTACTAAACGAC---GATCAACTATATAACGTTGTAGTTACAGCCCATGGATTTATCATAATTTTTTTTTTAGTAATACCTATTATAATTGGAGGATTTGGTAATTGATTGGTTCCCTTAATATTAGGTGCCCCAGATATAGCTTTCCCTCGAATAAACAATATAAGATTTTGATTATTACCTCCTTCCTTAACACTATTACTAGCTTCCTCAGCTGTTGAAAGAGGGGCAGGTACAGGATGAACAGTCTACCCCCCTCTTTCTAGTAACTTATCTCATGCTGGCCCTTCAGTCGACTTAGCAATTTTTTCTCTACATTTAGCAGGTGTATCCTCTATTTTAGGAGCTATTAATTTCATTACTACAATTTTAAATATACGATGAGAAGGCTTACAAATAGAACGATTGCCTCTATTTGCTTGATCTGTATTTATTACCGCAATTTTATTATTATTATCGCTTCCTGTTCTAGCCGGAGCTATTACTATATTATTAACTGACCGAAATTTTAATACGACCTTTTTTGACCCGAGAGGAGGAGGGGACCCTATTTTATACCAACATTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gonatus kamtschaticus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!